Incidental Mutation 'R7745:Cpne2'
ID596799
Institutional Source Beutler Lab
Gene Symbol Cpne2
Ensembl Gene ENSMUSG00000034361
Gene Namecopine II
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R7745 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location94532990-94570531 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 94568684 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 466 (S466A)
Ref Sequence ENSEMBL: ENSMUSP00000045755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048653] [ENSMUST00000109537]
Predicted Effect probably damaging
Transcript: ENSMUST00000048653
AA Change: S466A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045755
Gene: ENSMUSG00000034361
AA Change: S466A

DomainStartEndE-ValueType
C2 24 130 1.82e-9 SMART
C2 155 261 8.25e-8 SMART
low complexity region 269 278 N/A INTRINSIC
VWA 305 507 7.26e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109537
AA Change: S465A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105163
Gene: ENSMUSG00000034361
AA Change: S465A

DomainStartEndE-ValueType
C2 24 130 1.82e-9 SMART
C2 155 261 8.25e-8 SMART
low complexity region 269 278 N/A INTRINSIC
VWA 305 506 8.94e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212550
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene is one of several genes that encodes a calcium-dependent protein containing two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A C 3: 60,038,472 S188R probably damaging Het
Aars T A 8: 111,041,657 I220N probably damaging Het
Abca15 A G 7: 120,332,217 N16S probably damaging Het
Adck1 A T 12: 88,456,800 M358L probably benign Het
Adck5 A T 15: 76,594,548 Q345L probably benign Het
Adgrl2 A G 3: 148,836,458 F876S probably damaging Het
Aebp2 T A 6: 140,623,858 L55Q unknown Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Aox3 T C 1: 58,176,517 V1036A possibly damaging Het
Aox4 A G 1: 58,240,707 D494G probably benign Het
Cacna1a C A 8: 84,559,394 H889Q probably benign Het
Cacna1c T C 6: 119,052,626 D151G Het
Car8 A G 4: 8,237,939 V92A possibly damaging Het
Ccdc8 G T 7: 16,995,689 A368S unknown Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Cntnap5a A G 1: 116,442,283 I877V probably benign Het
Copa A T 1: 172,111,942 D582V probably damaging Het
Crybg2 A G 4: 134,088,845 K1311R possibly damaging Het
Csmd1 A G 8: 15,932,461 probably null Het
Dnah2 A T 11: 69,451,318 C2947* probably null Het
Exoc1 A T 5: 76,561,512 K656* probably null Het
Exoc8 T C 8: 124,895,819 N603S probably benign Het
Fam171a1 T A 2: 3,225,446 C539S possibly damaging Het
Fastkd5 A T 2: 130,615,068 I534K probably damaging Het
Fbn1 T C 2: 125,303,195 D2708G probably benign Het
Fhad1 A G 4: 141,890,939 L1392P probably benign Het
Fras1 A T 5: 96,726,895 T2306S probably benign Het
Gdf7 G T 12: 8,301,854 A27E unknown Het
Hnrnph1 A T 11: 50,379,497 I43F probably damaging Het
Igkv8-27 T A 6: 70,172,015 S52C probably benign Het
Jmjd1c T C 10: 67,217,045 F24L probably damaging Het
Knl1 T G 2: 119,071,556 L1246R probably benign Het
Limk2 C T 11: 3,355,896 S191N probably damaging Het
Mdga2 G A 12: 66,689,350 A368V probably damaging Het
Mdga2 C A 12: 66,689,351 A368S possibly damaging Het
Med24 A T 11: 98,704,967 L966Q probably damaging Het
Mgll T C 6: 88,725,788 V23A possibly damaging Het
Nedd1 C T 10: 92,714,172 D84N probably benign Het
Obscn A C 11: 59,060,855 L4024R probably damaging Het
Olfr172 A T 16: 58,760,419 Y252* probably null Het
Pcnx2 T C 8: 125,851,107 I944V probably benign Het
Pecr T C 1: 72,266,998 probably null Het
Phf3 A T 1: 30,804,224 W1885R probably damaging Het
Pitpnm2 C G 5: 124,128,705 A697P probably benign Het
Piwil2 T A 14: 70,394,189 H602L probably benign Het
Pprc1 T C 19: 46,065,342 S1104P unknown Het
Prkar1a T A 11: 109,653,847 Y21* probably null Het
Prl2c3 A T 13: 12,798,297 Y9* probably null Het
Rhbdl3 T A 11: 80,323,579 L172Q possibly damaging Het
Rsph3a T G 17: 7,979,243 L484W probably damaging Het
Sbno1 A T 5: 124,392,899 S809T probably benign Het
Stmnd1 T A 13: 46,299,601 V251E possibly damaging Het
Stt3a A T 9: 36,751,239 C241* probably null Het
Tas2r114 A T 6: 131,689,438 M209K probably damaging Het
Tchh G T 3: 93,444,777 R508L unknown Het
Tgfbr3l T C 8: 4,250,622 S267P possibly damaging Het
Ttn T A 2: 76,767,800 I19590F probably damaging Het
Vmn1r171 A G 7: 23,632,610 T87A probably benign Het
Other mutations in Cpne2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:Cpne2 APN 8 94554753 missense possibly damaging 0.84
IGL02702:Cpne2 APN 8 94570023 missense probably benign 0.03
IGL03277:Cpne2 APN 8 94548372 missense probably benign 0.00
R0018:Cpne2 UTSW 8 94556053 missense possibly damaging 0.93
R0018:Cpne2 UTSW 8 94556053 missense possibly damaging 0.93
R0126:Cpne2 UTSW 8 94554933 missense probably damaging 1.00
R0135:Cpne2 UTSW 8 94554925 unclassified probably benign
R0167:Cpne2 UTSW 8 94568579 unclassified probably benign
R0661:Cpne2 UTSW 8 94556039 missense possibly damaging 0.78
R0671:Cpne2 UTSW 8 94548342 start gained probably benign
R4691:Cpne2 UTSW 8 94558221 missense probably damaging 0.99
R4856:Cpne2 UTSW 8 94563964 missense probably benign 0.00
R4886:Cpne2 UTSW 8 94563964 missense probably benign 0.00
R6632:Cpne2 UTSW 8 94554955 missense probably benign 0.00
R6699:Cpne2 UTSW 8 94563959 missense probably damaging 0.99
R6968:Cpne2 UTSW 8 94548502 missense probably damaging 1.00
R7117:Cpne2 UTSW 8 94555544 missense probably damaging 1.00
R7505:Cpne2 UTSW 8 94548466 missense possibly damaging 0.90
R7571:Cpne2 UTSW 8 94551780 missense probably benign
R7583:Cpne2 UTSW 8 94555581 missense probably benign
R7612:Cpne2 UTSW 8 94557420 missense probably benign 0.01
R7845:Cpne2 UTSW 8 94551204 missense probably benign 0.16
R7928:Cpne2 UTSW 8 94551204 missense probably benign 0.16
R8278:Cpne2 UTSW 8 94554688 missense probably damaging 1.00
R8319:Cpne2 UTSW 8 94553412 missense probably benign 0.01
X0025:Cpne2 UTSW 8 94557451 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTCCAAGATGTCCATGGTATG -3'
(R):5'- AGGAATCTGAGACTATGAGCTCTG -3'

Sequencing Primer
(F):5'- ATGGTTTGCCTCCTTCAGG -3'
(R):5'- TCTGTCAGAGACCCTCCCAAC -3'
Posted On2019-11-26