Incidental Mutation 'R7745:Piwil2'
ID596818
Institutional Source Beutler Lab
Gene Symbol Piwil2
Ensembl Gene ENSMUSG00000033644
Gene Namepiwi-like RNA-mediated gene silencing 2
SynonymsMiwi like, mili
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7745 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location70372477-70429383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70394189 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 602 (H602L)
Ref Sequence ENSEMBL: ENSMUSP00000047385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048129]
PDB Structure
Structure of extended Tudor domain TD3 from mouse TDRD1 in complex with MILI peptide containing dimethylarginine 45. [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000048129
AA Change: H602L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047385
Gene: ENSMUSG00000033644
AA Change: H602L

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 90 102 N/A INTRINSIC
low complexity region 176 190 N/A INTRINSIC
DUF1785 335 386 7.44e-2 SMART
PAZ 386 524 1.92e-62 SMART
Piwi 666 957 2.45e-119 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PIWIL2 belongs to the Argonaute family of proteins, which function in development and maintenance of germline stem cells (Sasaki et al., 2003 [PubMed 12906857]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased testis weight, azoospermia, and male infertility associated with a complete arrest of spermatogenesis and increased apoptotic cell death during the early prophase of the first meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A C 3: 60,038,472 S188R probably damaging Het
Aars T A 8: 111,041,657 I220N probably damaging Het
Abca15 A G 7: 120,332,217 N16S probably damaging Het
Adck1 A T 12: 88,456,800 M358L probably benign Het
Adck5 A T 15: 76,594,548 Q345L probably benign Het
Adgrl2 A G 3: 148,836,458 F876S probably damaging Het
Aebp2 T A 6: 140,623,858 L55Q unknown Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Aox3 T C 1: 58,176,517 V1036A possibly damaging Het
Aox4 A G 1: 58,240,707 D494G probably benign Het
Cacna1a C A 8: 84,559,394 H889Q probably benign Het
Cacna1c T C 6: 119,052,626 D151G Het
Car8 A G 4: 8,237,939 V92A possibly damaging Het
Ccdc8 G T 7: 16,995,689 A368S unknown Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cntnap5a A G 1: 116,442,283 I877V probably benign Het
Copa A T 1: 172,111,942 D582V probably damaging Het
Cpne2 T G 8: 94,568,684 S466A probably damaging Het
Crybg2 A G 4: 134,088,845 K1311R possibly damaging Het
Csmd1 A G 8: 15,932,461 probably null Het
Dnah2 A T 11: 69,451,318 C2947* probably null Het
Exoc1 A T 5: 76,561,512 K656* probably null Het
Exoc8 T C 8: 124,895,819 N603S probably benign Het
Fam171a1 T A 2: 3,225,446 C539S possibly damaging Het
Fastkd5 A T 2: 130,615,068 I534K probably damaging Het
Fbn1 T C 2: 125,303,195 D2708G probably benign Het
Fhad1 A G 4: 141,890,939 L1392P probably benign Het
Fras1 A T 5: 96,726,895 T2306S probably benign Het
Gdf7 G T 12: 8,301,854 A27E unknown Het
Hnrnph1 A T 11: 50,379,497 I43F probably damaging Het
Igkv8-27 T A 6: 70,172,015 S52C probably benign Het
Jmjd1c T C 10: 67,217,045 F24L probably damaging Het
Knl1 T G 2: 119,071,556 L1246R probably benign Het
Limk2 C T 11: 3,355,896 S191N probably damaging Het
Mdga2 G A 12: 66,689,350 A368V probably damaging Het
Mdga2 C A 12: 66,689,351 A368S possibly damaging Het
Med24 A T 11: 98,704,967 L966Q probably damaging Het
Mgll T C 6: 88,725,788 V23A possibly damaging Het
Nedd1 C T 10: 92,714,172 D84N probably benign Het
Obscn A C 11: 59,060,855 L4024R probably damaging Het
Olfr172 A T 16: 58,760,419 Y252* probably null Het
Pcnx2 T C 8: 125,851,107 I944V probably benign Het
Pecr T C 1: 72,266,998 probably null Het
Phf3 A T 1: 30,804,224 W1885R probably damaging Het
Pitpnm2 C G 5: 124,128,705 A697P probably benign Het
Pprc1 T C 19: 46,065,342 S1104P unknown Het
Prkar1a T A 11: 109,653,847 Y21* probably null Het
Prl2c3 A T 13: 12,798,297 Y9* probably null Het
Rhbdl3 T A 11: 80,323,579 L172Q possibly damaging Het
Rsph3a T G 17: 7,979,243 L484W probably damaging Het
Sbno1 A T 5: 124,392,899 S809T probably benign Het
Stmnd1 T A 13: 46,299,601 V251E possibly damaging Het
Stt3a A T 9: 36,751,239 C241* probably null Het
Tas2r114 A T 6: 131,689,438 M209K probably damaging Het
Tchh G T 3: 93,444,777 R508L unknown Het
Tgfbr3l T C 8: 4,250,622 S267P possibly damaging Het
Ttn T A 2: 76,767,800 I19590F probably damaging Het
Vmn1r171 A G 7: 23,632,610 T87A probably benign Het
Other mutations in Piwil2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Piwil2 APN 14 70398218 missense probably benign 0.35
IGL02215:Piwil2 APN 14 70391373 missense possibly damaging 0.50
IGL02427:Piwil2 APN 14 70398134 splice site probably benign
IGL02554:Piwil2 APN 14 70391486 splice site probably benign
R0257:Piwil2 UTSW 14 70422631 missense probably benign 0.00
R0566:Piwil2 UTSW 14 70410394 missense probably damaging 0.99
R0800:Piwil2 UTSW 14 70409037 unclassified probably benign
R0828:Piwil2 UTSW 14 70376017 missense probably damaging 1.00
R0862:Piwil2 UTSW 14 70395374 missense probably benign 0.00
R0864:Piwil2 UTSW 14 70395374 missense probably benign 0.00
R0881:Piwil2 UTSW 14 70408927 missense probably benign 0.34
R1734:Piwil2 UTSW 14 70426505 critical splice donor site probably null
R1997:Piwil2 UTSW 14 70426658 missense possibly damaging 0.90
R2011:Piwil2 UTSW 14 70426634 missense probably damaging 1.00
R2043:Piwil2 UTSW 14 70391470 missense probably benign 0.00
R2347:Piwil2 UTSW 14 70408917 missense probably damaging 0.98
R2998:Piwil2 UTSW 14 70411238 missense probably damaging 1.00
R4402:Piwil2 UTSW 14 70408916 missense probably benign 0.01
R4455:Piwil2 UTSW 14 70390565 missense probably benign 0.02
R4611:Piwil2 UTSW 14 70402197 missense probably benign 0.07
R4763:Piwil2 UTSW 14 70376778 missense probably damaging 1.00
R4869:Piwil2 UTSW 14 70395362 missense probably benign 0.00
R5033:Piwil2 UTSW 14 70421593 missense possibly damaging 0.71
R5207:Piwil2 UTSW 14 70392517 missense probably damaging 1.00
R5395:Piwil2 UTSW 14 70395397 missense probably benign 0.01
R5486:Piwil2 UTSW 14 70401431 missense probably benign 0.01
R5504:Piwil2 UTSW 14 70389899 missense probably benign 0.01
R5629:Piwil2 UTSW 14 70422967 missense probably damaging 1.00
R5967:Piwil2 UTSW 14 70390564 missense probably benign 0.00
R6167:Piwil2 UTSW 14 70422893 critical splice donor site probably null
R6168:Piwil2 UTSW 14 70395351 missense probably benign 0.04
R6517:Piwil2 UTSW 14 70374336 missense probably benign 0.44
R7261:Piwil2 UTSW 14 70374411 missense probably damaging 1.00
R7727:Piwil2 UTSW 14 70394057 missense probably damaging 1.00
R7833:Piwil2 UTSW 14 70395441 missense probably benign 0.02
R8044:Piwil2 UTSW 14 70391438 missense possibly damaging 0.90
R8066:Piwil2 UTSW 14 70420719 missense probably benign 0.00
R8516:Piwil2 UTSW 14 70420739 missense probably benign 0.19
X0023:Piwil2 UTSW 14 70398199 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTACCTCAACTCCCAGTAAGGAC -3'
(R):5'- GGTTGTTGTGGCCATATGTAAAA -3'

Sequencing Primer
(F):5'- CCGGCAATCTTTTCCAAC -3'
(R):5'- TGTATAGATGCGCTCAACCC -3'
Posted On2019-11-26