Incidental Mutation 'R7801:Tbx5'
List |< first << previous [record 40 of 47] next >> last >|
ID600525
Institutional Source Beutler Lab
Gene Symbol Tbx5
Ensembl Gene ENSMUSG00000018263
Gene NameT-box 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R7801 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location119832668-119885219 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119836999 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 29 (E29G)
Ref Sequence ENSEMBL: ENSMUSP00000018407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018407] [ENSMUST00000202504] [ENSMUST00000202723]
Predicted Effect probably benign
Transcript: ENSMUST00000018407
AA Change: E29G

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000018407
Gene: ENSMUSG00000018263
AA Change: E29G

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
TBOX 53 243 9.61e-129 SMART
low complexity region 381 392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202504
AA Change: E29G

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143828
Gene: ENSMUSG00000018263
AA Change: E29G

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
TBOX 53 218 6.3e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202723
AA Change: E29G

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144418
Gene: ENSMUSG00000018263
AA Change: E29G

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
TBOX 53 120 3.1e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is closely linked to related family member T-box 3 (ulnar mammary syndrome) on human chromosome 12. The encoded protein may play a role in heart development and specification of limb identity. Mutations in this gene have been associated with Holt-Oram syndrome, a developmental disorder affecting the heart and upper limbs. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Heterozygous null mice exhibit strain-dependent perinatal lethality, forelimb and variable congenital heart malformations, whereas homozygous null mice are growth arrested and die by E10.5 of severe heart defects. Hypomorphic mutants show milder defects both in the hetero- and homozygous null state. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,630,485 Y165C probably damaging Het
Agbl3 A T 6: 34,839,365 T742S probably benign Het
Arhgef10l T C 4: 140,544,267 T651A probably benign Het
Arsb T A 13: 93,862,327 I381N probably damaging Het
Blzf1 A G 1: 164,295,909 V283A probably benign Het
C130060K24Rik T A 6: 65,441,217 V123D probably damaging Het
Cadps C T 14: 12,489,476 probably null Het
Casz1 A T 4: 148,938,249 T591S probably damaging Het
Ccne2 T C 4: 11,194,079 probably null Het
Chst9 T C 18: 15,452,277 T410A probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Fam234a T C 17: 26,218,198 D169G probably benign Het
Fat1 C T 8: 45,042,223 P4116L probably damaging Het
Fbxo21 G T 5: 117,986,124 A166S probably damaging Het
Gbf1 A G 19: 46,272,643 I1216V probably benign Het
Gper1 G A 5: 139,426,688 A263T probably benign Het
Hdlbp G T 1: 93,430,307 probably null Het
Ighg3 A T 12: 113,359,816 L280Q Het
Impa1 T C 3: 10,321,667 T171A probably benign Het
Ints7 T A 1: 191,615,747 Y744N possibly damaging Het
Irgc1 G T 7: 24,432,534 A286D probably damaging Het
Kif18a T C 2: 109,287,845 S2P probably damaging Het
Macf1 A T 4: 123,408,271 W813R probably damaging Het
Mapkbp1 T G 2: 120,012,073 H157Q probably damaging Het
Mfsd4b2 T A 10: 39,923,781 M42L probably benign Het
Mon2 A G 10: 123,059,186 probably null Het
Myrfl T A 10: 116,848,335 H161L probably benign Het
Olfr171 T C 16: 19,624,623 H159R probably damaging Het
Olfr832 A C 9: 18,945,259 S204R probably damaging Het
Phlpp2 T G 8: 109,925,842 V606G possibly damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Ptpn9 A G 9: 57,061,013 T546A probably benign Het
Rabep2 A G 7: 126,438,412 M146V possibly damaging Het
Rptn G A 3: 93,398,224 E955K possibly damaging Het
Samd3 G T 10: 26,263,872 V301F possibly damaging Het
Sh2b1 C A 7: 126,471,292 C380F probably benign Het
Shank1 A G 7: 44,351,598 M914V unknown Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Stat5a T C 11: 100,880,317 F574S probably damaging Het
Trpm5 A C 7: 143,085,241 D264E probably damaging Het
Zfp442 T C 2: 150,409,719 S88G probably benign Het
Zfp62 T A 11: 49,217,328 F749I possibly damaging Het
Zfp677 T A 17: 21,398,015 S445T probably damaging Het
Zfp979 A C 4: 147,613,978 N91K probably damaging Het
Zfyve9 A G 4: 108,684,995 V209A possibly damaging Het
Zic4 G T 9: 91,384,244 A314S probably benign Het
Other mutations in Tbx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Tbx5 APN 5 119883026 missense probably benign
IGL01595:Tbx5 APN 5 119840838 missense probably damaging 1.00
IGL01758:Tbx5 APN 5 119844958 unclassified probably benign
IGL02239:Tbx5 APN 5 119871280 missense possibly damaging 0.68
IGL02625:Tbx5 APN 5 119836907 utr 5 prime probably benign
IGL03326:Tbx5 APN 5 119871298 missense probably damaging 0.99
R0477:Tbx5 UTSW 5 119883119 missense possibly damaging 0.89
R0485:Tbx5 UTSW 5 119883458 missense probably benign 0.00
R1218:Tbx5 UTSW 5 119838720 missense probably damaging 1.00
R1756:Tbx5 UTSW 5 119845113 splice site probably null
R2011:Tbx5 UTSW 5 119841906 splice site probably null
R2125:Tbx5 UTSW 5 119836923 missense probably benign
R2126:Tbx5 UTSW 5 119836923 missense probably benign
R2268:Tbx5 UTSW 5 119845109 splice site probably null
R2302:Tbx5 UTSW 5 119841859 missense probably damaging 1.00
R4693:Tbx5 UTSW 5 119841899 missense probably damaging 1.00
R4930:Tbx5 UTSW 5 119883025 missense probably benign 0.44
R5062:Tbx5 UTSW 5 119836922 missense probably damaging 0.99
R5245:Tbx5 UTSW 5 119883165 missense possibly damaging 0.95
R6067:Tbx5 UTSW 5 119883146 missense probably benign
R6079:Tbx5 UTSW 5 119883146 missense probably benign
R6138:Tbx5 UTSW 5 119883146 missense probably benign
R6218:Tbx5 UTSW 5 119853598 missense probably damaging 1.00
R6528:Tbx5 UTSW 5 119883111 missense probably damaging 0.97
R6700:Tbx5 UTSW 5 119871397 missense probably benign 0.30
R6993:Tbx5 UTSW 5 119871389 missense possibly damaging 0.75
R7777:Tbx5 UTSW 5 119883167 missense probably benign 0.00
R8056:Tbx5 UTSW 5 119853613 missense probably benign
U15987:Tbx5 UTSW 5 119883146 missense probably benign
X0028:Tbx5 UTSW 5 119845119 critical splice donor site probably null
Z1176:Tbx5 UTSW 5 119883315 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACAGCTTGTCCCCTATGTCG -3'
(R):5'- GCCTCGATAAAGTGGATTGGG -3'

Sequencing Primer
(F):5'- GTCGCTAGACACTCTCCAACTC -3'
(R):5'- GATTTGGTGAGACTAGCCAGG -3'
Posted On2019-11-26