Incidental Mutation 'R6218:Tbx5'
ID 503833
Institutional Source Beutler Lab
Gene Symbol Tbx5
Ensembl Gene ENSMUSG00000018263
Gene Name T-box 5
Synonyms
Accession Numbers
Essential gene? Probably essential (E-score: 0.936) question?
Stock # R6218 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 119970733-120023284 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 119991663 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 245 (H245Y)
Ref Sequence ENSEMBL: ENSMUSP00000018407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018407]
AlphaFold P70326
Predicted Effect probably damaging
Transcript: ENSMUST00000018407
AA Change: H245Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018407
Gene: ENSMUSG00000018263
AA Change: H245Y

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
TBOX 53 243 9.61e-129 SMART
low complexity region 381 392 N/A INTRINSIC
Meta Mutation Damage Score 0.2475 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is closely linked to related family member T-box 3 (ulnar mammary syndrome) on human chromosome 12. The encoded protein may play a role in heart development and specification of limb identity. Mutations in this gene have been associated with Holt-Oram syndrome, a developmental disorder affecting the heart and upper limbs. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Heterozygous null mice exhibit strain-dependent perinatal lethality, forelimb and variable congenital heart malformations, whereas homozygous null mice are growth arrested and die by E10.5 of severe heart defects. Hypomorphic mutants show milder defects both in the hetero- and homozygous null state. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik G T 11: 99,728,730 (GRCm39) Q38K probably benign Het
9930111J21Rik2 A T 11: 48,910,134 (GRCm39) N766K probably benign Het
Adam15 A C 3: 89,251,190 (GRCm39) I505S probably benign Het
Apc2 T C 10: 80,142,254 (GRCm39) M391T probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Bclaf1 A G 10: 20,210,374 (GRCm39) S840G probably benign Het
Cacna2d4 A G 6: 119,216,021 (GRCm39) Y96C probably damaging Het
Cald1 CAAAA CAAA 6: 34,724,863 (GRCm39) probably null Het
Ddhd1 A G 14: 45,851,633 (GRCm39) L141P probably damaging Het
Dnaaf3 A T 7: 4,526,671 (GRCm39) S469T probably benign Het
Dzip3 A T 16: 48,778,828 (GRCm39) M323K possibly damaging Het
Eci2 T A 13: 35,177,048 (GRCm39) probably null Het
Fam227b A T 2: 125,968,882 (GRCm39) V64E probably damaging Het
Galnt2 A G 8: 125,070,054 (GRCm39) I524V probably benign Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm3443 T A 19: 21,533,110 (GRCm39) S25T probably damaging Het
Gpr22 T A 12: 31,761,616 (GRCm39) K14* probably null Het
Grip1 T C 10: 119,822,251 (GRCm39) S405P possibly damaging Het
Helz2 T C 2: 180,877,738 (GRCm39) H1020R probably damaging Het
Helz2 C A 2: 180,874,087 (GRCm39) V2136L probably benign Het
Il36rn G A 2: 24,167,502 (GRCm39) probably benign Het
Iqsec1 T A 6: 90,666,617 (GRCm39) S607C probably damaging Het
Irag1 G A 7: 110,476,112 (GRCm39) T819M probably benign Het
Klhl2 A T 8: 65,205,801 (GRCm39) Y373* probably null Het
L3mbtl3 T C 10: 26,168,645 (GRCm39) I595V unknown Het
Large2 T C 2: 92,200,981 (GRCm39) D65G probably damaging Het
Lrrfip1 T C 1: 91,009,881 (GRCm39) Y122H probably damaging Het
Map1b A T 13: 99,569,714 (GRCm39) D1002E unknown Het
Mink1 C T 11: 70,489,720 (GRCm39) T59I possibly damaging Het
Myo7b T C 18: 32,092,507 (GRCm39) N2097D probably benign Het
Nbea C A 3: 55,535,905 (GRCm39) C2893F probably damaging Het
Nlgn1 A T 3: 25,490,257 (GRCm39) V490E probably damaging Het
Or2w1b G A 13: 21,300,401 (GRCm39) E180K probably damaging Het
Or2y3 A G 17: 38,393,620 (GRCm39) M83T probably damaging Het
Or4c123 G T 2: 89,127,306 (GRCm39) H103N probably damaging Het
Or4f62 T C 2: 111,986,701 (GRCm39) I135T probably damaging Het
Or4k2 C A 14: 50,424,135 (GRCm39) D180Y probably damaging Het
Pctp A G 11: 89,878,144 (GRCm39) I130T probably benign Het
Pdcl3 T C 1: 39,027,152 (GRCm39) probably null Het
Pheta2 T A 15: 82,227,917 (GRCm39) H145Q probably benign Het
Pira12 A T 7: 3,897,031 (GRCm39) S602T possibly damaging Het
Pkp1 T C 1: 135,807,646 (GRCm39) K541E probably damaging Het
Plekhh2 G A 17: 84,898,992 (GRCm39) V990I probably benign Het
Ppp1r3a A T 6: 14,718,430 (GRCm39) V828D probably damaging Het
Prrc2b T C 2: 32,098,823 (GRCm39) Y712H probably damaging Het
Prune2 T C 19: 17,098,926 (GRCm39) S1477P probably benign Het
Psma5 A G 3: 108,187,118 (GRCm39) K239R probably benign Het
Rhobtb1 G C 10: 69,106,286 (GRCm39) A284P probably benign Het
Samsn1 G A 16: 75,742,162 (GRCm39) noncoding transcript Het
Scel A G 14: 103,809,478 (GRCm39) T273A probably benign Het
Slc22a5 T A 11: 53,782,444 (GRCm39) probably benign Het
Slc25a37 A T 14: 69,486,953 (GRCm39) M110K possibly damaging Het
Slc6a2 A T 8: 93,708,609 (GRCm39) M242L probably benign Het
Slc8a3 C A 12: 81,246,341 (GRCm39) W904L probably benign Het
Ss18l1 G A 2: 179,696,905 (GRCm39) V109I probably benign Het
Thumpd2 C A 17: 81,360,342 (GRCm39) L244F probably damaging Het
Tmem107 T A 11: 68,962,241 (GRCm39) V66E probably damaging Het
Tnr T C 1: 159,715,884 (GRCm39) V882A possibly damaging Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Ttbk1 A G 17: 46,781,733 (GRCm39) V340A possibly damaging Het
Veph1 T C 3: 66,162,481 (GRCm39) E59G probably damaging Het
Vmn1r234 T A 17: 21,449,983 (GRCm39) M299K possibly damaging Het
Vps13b T C 15: 35,770,610 (GRCm39) Y2018H probably benign Het
Zbtb11 A G 16: 55,818,436 (GRCm39) E620G probably benign Het
Zfp418 A G 7: 7,185,627 (GRCm39) H530R possibly damaging Het
Zfp764l1 C T 7: 126,992,581 (GRCm39) A10T possibly damaging Het
Other mutations in Tbx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Tbx5 APN 5 120,021,091 (GRCm39) missense probably benign
IGL01595:Tbx5 APN 5 119,978,903 (GRCm39) missense probably damaging 1.00
IGL01758:Tbx5 APN 5 119,983,023 (GRCm39) unclassified probably benign
IGL02239:Tbx5 APN 5 120,009,345 (GRCm39) missense possibly damaging 0.68
IGL02625:Tbx5 APN 5 119,974,972 (GRCm39) utr 5 prime probably benign
IGL03326:Tbx5 APN 5 120,009,363 (GRCm39) missense probably damaging 0.99
R0477:Tbx5 UTSW 5 120,021,184 (GRCm39) missense possibly damaging 0.89
R0485:Tbx5 UTSW 5 120,021,523 (GRCm39) missense probably benign 0.00
R1218:Tbx5 UTSW 5 119,976,785 (GRCm39) missense probably damaging 1.00
R1756:Tbx5 UTSW 5 119,983,178 (GRCm39) splice site probably null
R2011:Tbx5 UTSW 5 119,979,971 (GRCm39) splice site probably null
R2125:Tbx5 UTSW 5 119,974,988 (GRCm39) missense probably benign
R2126:Tbx5 UTSW 5 119,974,988 (GRCm39) missense probably benign
R2268:Tbx5 UTSW 5 119,983,174 (GRCm39) splice site probably null
R2302:Tbx5 UTSW 5 119,979,924 (GRCm39) missense probably damaging 1.00
R4693:Tbx5 UTSW 5 119,979,964 (GRCm39) missense probably damaging 1.00
R4930:Tbx5 UTSW 5 120,021,090 (GRCm39) missense probably benign 0.44
R5062:Tbx5 UTSW 5 119,974,987 (GRCm39) missense probably damaging 0.99
R5245:Tbx5 UTSW 5 120,021,230 (GRCm39) missense possibly damaging 0.95
R6067:Tbx5 UTSW 5 120,021,211 (GRCm39) missense probably benign
R6079:Tbx5 UTSW 5 120,021,211 (GRCm39) missense probably benign
R6138:Tbx5 UTSW 5 120,021,211 (GRCm39) missense probably benign
R6528:Tbx5 UTSW 5 120,021,176 (GRCm39) missense probably damaging 0.97
R6700:Tbx5 UTSW 5 120,009,462 (GRCm39) missense probably benign 0.30
R6993:Tbx5 UTSW 5 120,009,454 (GRCm39) missense possibly damaging 0.75
R7777:Tbx5 UTSW 5 120,021,232 (GRCm39) missense probably benign 0.00
R7801:Tbx5 UTSW 5 119,975,064 (GRCm39) missense probably benign 0.44
R8056:Tbx5 UTSW 5 119,991,678 (GRCm39) missense probably benign
R8772:Tbx5 UTSW 5 119,976,790 (GRCm39) missense probably benign 0.02
R9706:Tbx5 UTSW 5 119,979,909 (GRCm39) missense probably benign 0.42
U15987:Tbx5 UTSW 5 120,021,211 (GRCm39) missense probably benign
X0028:Tbx5 UTSW 5 119,983,184 (GRCm39) critical splice donor site probably null
Z1176:Tbx5 UTSW 5 120,021,380 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCCTGTCACTGTGATGGCTG -3'
(R):5'- TCCAGATCCTAAGGGTTATGAGAAG -3'

Sequencing Primer
(F):5'- CACTGTGATGGCTGCGTTG -3'
(R):5'- CATGGTGAGACTTGCTTGCAATACC -3'
Posted On 2018-02-27