Mutagenetix > Incidental Mutations

Incidental Mutation 'R6218:Tbx5'

503833

Institutional Source

Beutler Lab

Gene Symbol

Tbx5

Ensembl Gene

ENSMUSG00000018263

Gene Name

T-box 5

Synonyms

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.938) question?

Stock #

R6218 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119832668-119885219 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 119853598 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 245 (H245Y)

Ref Sequence

ENSEMBL: ENSMUSP00000018407 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018407]

Predicted Effect

probably damaging
Transcript: ENSMUST00000018407
AA Change: H245Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000018407
Gene: ENSMUSG00000018263
AA Change: H245Y

Domain	Start	End	E-Value	Type
low complexity region	34	45	N/A	INTRINSIC
TBOX	53	243	9.61e-129	SMART
low complexity region	381	392	N/A	INTRINSIC

Meta Mutation Damage Score

0.2475

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is closely linked to related family member T-box 3 (ulnar mammary syndrome) on human chromosome 12. The encoded protein may play a role in heart development and specification of limb identity. Mutations in this gene have been associated with Holt-Oram syndrome, a developmental disorder affecting the heart and upper limbs. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Heterozygous null mice exhibit strain-dependent perinatal lethality, forelimb and variable congenital heart malformations, whereas homozygous null mice are growth arrested and die by E10.5 of severe heart defects. Hypomorphic mutants show milder defects both in the hetero- and homozygous null state. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2300003K06Rik	G	T	11: 99,837,904	Q38K	probably benign	Het
9930111J21Rik2	A	T	11: 49,019,307	N766K	probably benign	Het
Adam15	A	C	3: 89,343,883	I505S	probably benign	Het
Apc2	T	C	10: 80,306,420	M391T	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Bclaf1	A	G	10: 20,334,628	S840G	probably benign	Het
Cacna2d4	A	G	6: 119,239,060	Y96C	probably damaging	Het
Cald1	CAAAA	CAAA	6: 34,747,928		probably null	Het
Ddhd1	A	G	14: 45,614,176	L141P	probably damaging	Het
Dnaaf3	A	T	7: 4,523,672	S469T	probably benign	Het
Dzip3	A	T	16: 48,958,465	M323K	possibly damaging	Het
E430018J23Rik	C	T	7: 127,393,409	A10T	possibly damaging	Het
Eci2	T	A	13: 34,993,065		probably null	Het
Fam109b	T	A	15: 82,343,716	H145Q	probably benign	Het
Fam227b	A	T	2: 126,126,962	V64E	probably damaging	Het
Galnt2	A	G	8: 124,343,315	I524V	probably benign	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm14548	A	T	7: 3,894,032	S602T	possibly damaging	Het
Gm3443	T	A	19: 21,555,746	S25T	probably damaging	Het
Gpr22	T	A	12: 31,711,617	K14*	probably null	Het
Grip1	T	C	10: 119,986,346	S405P	possibly damaging	Het
Helz2	C	A	2: 181,232,294	V2136L	probably benign	Het
Helz2	T	C	2: 181,235,945	H1020R	probably damaging	Het
Il1f5	G	A	2: 24,277,490		probably benign	Het
Iqsec1	T	A	6: 90,689,635	S607C	probably damaging	Het
Klhl2	A	T	8: 64,752,767	Y373*	probably null	Het
L3mbtl3	T	C	10: 26,292,747	I595V	unknown	Het
Large2	T	C	2: 92,370,636	D65G	probably damaging	Het
Lrrfip1	T	C	1: 91,082,159	Y122H	probably damaging	Het
Map1b	A	T	13: 99,433,206	D1002E	unknown	Het
Mink1	C	T	11: 70,598,894	T59I	possibly damaging	Het
Mrvi1	G	A	7: 110,876,905	T819M	probably benign	Het
Myo7b	T	C	18: 31,959,454	N2097D	probably benign	Het
Nbea	C	A	3: 55,628,484	C2893F	probably damaging	Het
Nlgn1	A	T	3: 25,436,093	V490E	probably damaging	Het
Olfr1230	G	T	2: 89,296,962	H103N	probably damaging	Het
Olfr131	A	G	17: 38,082,729	M83T	probably damaging	Het
Olfr1318	T	C	2: 112,156,356	I135T	probably damaging	Het
Olfr1369-ps1	G	A	13: 21,116,231	E180K	probably damaging	Het
Olfr730	C	A	14: 50,186,678	D180Y	probably damaging	Het
Pctp	A	G	11: 89,987,318	I130T	probably benign	Het
Pdcl3	T	C	1: 38,988,071		probably null	Het
Pkp1	T	C	1: 135,879,908	K541E	probably damaging	Het
Plekhh2	G	A	17: 84,591,564	V990I	probably benign	Het
Ppp1r3a	A	T	6: 14,718,431	V828D	probably damaging	Het
Prrc2b	T	C	2: 32,208,811	Y712H	probably damaging	Het
Prune2	T	C	19: 17,121,562	S1477P	probably benign	Het
Psma5	A	G	3: 108,279,802	K239R	probably benign	Het
Rhobtb1	G	C	10: 69,270,456	A284P	probably benign	Het
Samsn1	G	A	16: 75,945,274		noncoding transcript	Het
Scel	A	G	14: 103,572,042	T273A	probably benign	Het
Slc22a5	T	A	11: 53,891,618		probably benign	Het
Slc25a37	A	T	14: 69,249,504	M110K	possibly damaging	Het
Slc6a2	A	T	8: 92,981,981	M242L	probably benign	Het
Slc8a3	C	A	12: 81,199,567	W904L	probably benign	Het
Ss18l1	G	A	2: 180,055,112	V109I	probably benign	Het
Thumpd2	C	A	17: 81,052,913	L244F	probably damaging	Het
Tmem107	T	A	11: 69,071,415	V66E	probably damaging	Het
Tnr	T	C	1: 159,888,314	V882A	possibly damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Ttbk1	A	G	17: 46,470,807	V340A	possibly damaging	Het
Veph1	T	C	3: 66,255,060	E59G	probably damaging	Het
Vmn1r234	T	A	17: 21,229,721	M299K	possibly damaging	Het
Vps13b	T	C	15: 35,770,464	Y2018H	probably benign	Het
Zbtb11	A	G	16: 55,998,073	E620G	probably benign	Het
Zfp418	A	G	7: 7,182,628	H530R	possibly damaging	Het

Other mutations in Tbx5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01096:Tbx5	APN	5	119883026	missense	probably benign
IGL01595:Tbx5	APN	5	119840838	missense	probably damaging	1.00
IGL01758:Tbx5	APN	5	119844958	unclassified	probably benign
IGL02239:Tbx5	APN	5	119871280	missense	possibly damaging	0.68
IGL02625:Tbx5	APN	5	119836907	utr 5 prime	probably benign
IGL03326:Tbx5	APN	5	119871298	missense	probably damaging	0.99
R0477:Tbx5	UTSW	5	119883119	missense	possibly damaging	0.89
R0485:Tbx5	UTSW	5	119883458	missense	probably benign	0.00
R1218:Tbx5	UTSW	5	119838720	missense	probably damaging	1.00
R1756:Tbx5	UTSW	5	119845113	splice site	probably null
R2011:Tbx5	UTSW	5	119841906	splice site	probably null
R2125:Tbx5	UTSW	5	119836923	missense	probably benign
R2126:Tbx5	UTSW	5	119836923	missense	probably benign
R2268:Tbx5	UTSW	5	119845109	splice site	probably null
R2302:Tbx5	UTSW	5	119841859	missense	probably damaging	1.00
R4693:Tbx5	UTSW	5	119841899	missense	probably damaging	1.00
R4930:Tbx5	UTSW	5	119883025	missense	probably benign	0.44
R5062:Tbx5	UTSW	5	119836922	missense	probably damaging	0.99
R5245:Tbx5	UTSW	5	119883165	missense	possibly damaging	0.95
R6067:Tbx5	UTSW	5	119883146	missense	probably benign
R6079:Tbx5	UTSW	5	119883146	missense	probably benign
R6138:Tbx5	UTSW	5	119883146	missense	probably benign
R6528:Tbx5	UTSW	5	119883111	missense	probably damaging	0.97
R6700:Tbx5	UTSW	5	119871397	missense	probably benign	0.30
R6993:Tbx5	UTSW	5	119871389	missense	possibly damaging	0.75
R7777:Tbx5	UTSW	5	119883167	missense	probably benign	0.00
R7801:Tbx5	UTSW	5	119836999	missense	probably benign	0.44
R8056:Tbx5	UTSW	5	119853613	missense	probably benign
R8772:Tbx5	UTSW	5	119838725	missense	probably benign	0.02
U15987:Tbx5	UTSW	5	119883146	missense	probably benign
X0028:Tbx5	UTSW	5	119845119	critical splice donor site	probably null
Z1176:Tbx5	UTSW	5	119883315	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TCCTGTCACTGTGATGGCTG -3'
(R):5'- TCCAGATCCTAAGGGTTATGAGAAG -3'

Sequencing Primer
(F):5'- CACTGTGATGGCTGCGTTG -3'
(R):5'- CATGGTGAGACTTGCTTGCAATACC -3'

Posted On

2018-02-27