Incidental Mutation 'R6218:Tbx5'
ID503833
Institutional Source Beutler Lab
Gene Symbol Tbx5
Ensembl Gene ENSMUSG00000018263
Gene NameT-box 5
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.941) question?
Stock #R6218 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location119832668-119885219 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119853598 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 245 (H245Y)
Ref Sequence ENSEMBL: ENSMUSP00000018407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018407]
Predicted Effect probably damaging
Transcript: ENSMUST00000018407
AA Change: H245Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018407
Gene: ENSMUSG00000018263
AA Change: H245Y

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
TBOX 53 243 9.61e-129 SMART
low complexity region 381 392 N/A INTRINSIC
Meta Mutation Damage Score 0.2475 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is closely linked to related family member T-box 3 (ulnar mammary syndrome) on human chromosome 12. The encoded protein may play a role in heart development and specification of limb identity. Mutations in this gene have been associated with Holt-Oram syndrome, a developmental disorder affecting the heart and upper limbs. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Heterozygous null mice exhibit strain-dependent perinatal lethality, forelimb and variable congenital heart malformations, whereas homozygous null mice are growth arrested and die by E10.5 of severe heart defects. Hypomorphic mutants show milder defects both in the hetero- and homozygous null state. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300003K06Rik G T 11: 99,837,904 Q38K probably benign Het
9930111J21Rik2 A T 11: 49,019,307 N766K probably benign Het
Adam15 A C 3: 89,343,883 I505S probably benign Het
Apc2 T C 10: 80,306,420 M391T probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bclaf1 A G 10: 20,334,628 S840G probably benign Het
Cacna2d4 A G 6: 119,239,060 Y96C probably damaging Het
Cald1 CAAAA CAAA 6: 34,747,928 probably null Het
Ddhd1 A G 14: 45,614,176 L141P probably damaging Het
Dnaaf3 A T 7: 4,523,672 S469T probably benign Het
Dzip3 A T 16: 48,958,465 M323K possibly damaging Het
E430018J23Rik C T 7: 127,393,409 A10T possibly damaging Het
Eci2 T A 13: 34,993,065 probably null Het
Fam109b T A 15: 82,343,716 H145Q probably benign Het
Fam227b A T 2: 126,126,962 V64E probably damaging Het
Galnt2 A G 8: 124,343,315 I524V probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14548 A T 7: 3,894,032 S602T possibly damaging Het
Gm3443 T A 19: 21,555,746 S25T probably damaging Het
Gpr22 T A 12: 31,711,617 K14* probably null Het
Grip1 T C 10: 119,986,346 S405P possibly damaging Het
Helz2 C A 2: 181,232,294 V2136L probably benign Het
Helz2 T C 2: 181,235,945 H1020R probably damaging Het
Il1f5 G A 2: 24,277,490 probably benign Het
Iqsec1 T A 6: 90,689,635 S607C probably damaging Het
Klhl2 A T 8: 64,752,767 Y373* probably null Het
L3mbtl3 T C 10: 26,292,747 I595V unknown Het
Large2 T C 2: 92,370,636 D65G probably damaging Het
Lrrfip1 T C 1: 91,082,159 Y122H probably damaging Het
Map1b A T 13: 99,433,206 D1002E unknown Het
Mink1 C T 11: 70,598,894 T59I possibly damaging Het
Mrvi1 G A 7: 110,876,905 T819M probably benign Het
Myo7b T C 18: 31,959,454 N2097D probably benign Het
Nbea C A 3: 55,628,484 C2893F probably damaging Het
Nlgn1 A T 3: 25,436,093 V490E probably damaging Het
Olfr1230 G T 2: 89,296,962 H103N probably damaging Het
Olfr131 A G 17: 38,082,729 M83T probably damaging Het
Olfr1318 T C 2: 112,156,356 I135T probably damaging Het
Olfr1369-ps1 G A 13: 21,116,231 E180K probably damaging Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Pctp A G 11: 89,987,318 I130T probably benign Het
Pdcl3 T C 1: 38,988,071 probably null Het
Pkp1 T C 1: 135,879,908 K541E probably damaging Het
Plekhh2 G A 17: 84,591,564 V990I probably benign Het
Ppp1r3a A T 6: 14,718,431 V828D probably damaging Het
Prrc2b T C 2: 32,208,811 Y712H probably damaging Het
Prune2 T C 19: 17,121,562 S1477P probably benign Het
Psma5 A G 3: 108,279,802 K239R probably benign Het
Rhobtb1 G C 10: 69,270,456 A284P probably benign Het
Samsn1 G A 16: 75,945,274 noncoding transcript Het
Scel A G 14: 103,572,042 T273A probably benign Het
Slc22a5 T A 11: 53,891,618 probably benign Het
Slc25a37 A T 14: 69,249,504 M110K possibly damaging Het
Slc6a2 A T 8: 92,981,981 M242L probably benign Het
Slc8a3 C A 12: 81,199,567 W904L probably benign Het
Ss18l1 G A 2: 180,055,112 V109I probably benign Het
Thumpd2 C A 17: 81,052,913 L244F probably damaging Het
Tmem107 T A 11: 69,071,415 V66E probably damaging Het
Tnr T C 1: 159,888,314 V882A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttbk1 A G 17: 46,470,807 V340A possibly damaging Het
Veph1 T C 3: 66,255,060 E59G probably damaging Het
Vmn1r234 T A 17: 21,229,721 M299K possibly damaging Het
Vps13b T C 15: 35,770,464 Y2018H probably benign Het
Zbtb11 A G 16: 55,998,073 E620G probably benign Het
Zfp418 A G 7: 7,182,628 H530R possibly damaging Het
Other mutations in Tbx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Tbx5 APN 5 119883026 missense probably benign
IGL01595:Tbx5 APN 5 119840838 missense probably damaging 1.00
IGL01758:Tbx5 APN 5 119844958 unclassified probably benign
IGL02239:Tbx5 APN 5 119871280 missense possibly damaging 0.68
IGL02625:Tbx5 APN 5 119836907 utr 5 prime probably benign
IGL03326:Tbx5 APN 5 119871298 missense probably damaging 0.99
R0477:Tbx5 UTSW 5 119883119 missense possibly damaging 0.89
R0485:Tbx5 UTSW 5 119883458 missense probably benign 0.00
R1218:Tbx5 UTSW 5 119838720 missense probably damaging 1.00
R1756:Tbx5 UTSW 5 119845113 unclassified probably null
R2011:Tbx5 UTSW 5 119841906 splice site probably null
R2125:Tbx5 UTSW 5 119836923 missense probably benign
R2126:Tbx5 UTSW 5 119836923 missense probably benign
R2268:Tbx5 UTSW 5 119845109 splice site probably null
R2302:Tbx5 UTSW 5 119841859 missense probably damaging 1.00
R4693:Tbx5 UTSW 5 119841899 missense probably damaging 1.00
R4930:Tbx5 UTSW 5 119883025 missense probably benign 0.44
R5062:Tbx5 UTSW 5 119836922 missense probably damaging 0.99
R5245:Tbx5 UTSW 5 119883165 missense possibly damaging 0.95
R6067:Tbx5 UTSW 5 119883146 missense probably benign
R6079:Tbx5 UTSW 5 119883146 missense probably benign
R6138:Tbx5 UTSW 5 119883146 missense probably benign
R6528:Tbx5 UTSW 5 119883111 missense probably damaging 0.97
R6700:Tbx5 UTSW 5 119871397 missense probably benign 0.30
R6993:Tbx5 UTSW 5 119871389 missense possibly damaging 0.75
R7777:Tbx5 UTSW 5 119883167 missense probably benign 0.00
R7801:Tbx5 UTSW 5 119836999 missense probably benign 0.44
R8056:Tbx5 UTSW 5 119853613 missense probably benign
U15987:Tbx5 UTSW 5 119883146 missense probably benign
X0028:Tbx5 UTSW 5 119845119 critical splice donor site probably null
Z1176:Tbx5 UTSW 5 119883315 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCCTGTCACTGTGATGGCTG -3'
(R):5'- TCCAGATCCTAAGGGTTATGAGAAG -3'

Sequencing Primer
(F):5'- CACTGTGATGGCTGCGTTG -3'
(R):5'- CATGGTGAGACTTGCTTGCAATACC -3'
Posted On2018-02-27