Mutagenetix > Incidental Mutations

Incidental Mutation 'R1756:Tbx5'

194852

Institutional Source

Beutler Lab

Gene Symbol

Tbx5

Ensembl Gene

ENSMUSG00000018263

Gene Name

T-box 5

Synonyms

MMRRC Submission

039788-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.943) question?

Stock #

R1756 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119832668-119885219 bp(+) (GRCm38)

Type of Mutation

unclassified (3 bp from exon)

DNA Base Change (assembly)

A to T at 119845113 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000143828 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018407] [ENSMUST00000202504] [ENSMUST00000202723]

Predicted Effect

probably benign
Transcript: ENSMUST00000018407
AA Change: H220L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000018407
Gene: ENSMUSG00000018263
AA Change: H220L

Domain	Start	End	E-Value	Type
low complexity region	34	45	N/A	INTRINSIC
TBOX	53	243	9.61e-129	SMART
low complexity region	381	392	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000202504

SMART Domains

Protein: ENSMUSP00000143828
Gene: ENSMUSG00000018263

Domain	Start	End	E-Value	Type
low complexity region	34	45	N/A	INTRINSIC
TBOX	53	218	6.3e-100	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000202723

SMART Domains

Protein: ENSMUSP00000144418
Gene: ENSMUSG00000018263

Domain	Start	End	E-Value	Type
low complexity region	34	45	N/A	INTRINSIC
TBOX	53	120	3.1e-9	SMART

Meta Mutation Damage Score

0.1082

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.5%
20x: 93.0%

Validation Efficiency

100% (96/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is closely linked to related family member T-box 3 (ulnar mammary syndrome) on human chromosome 12. The encoded protein may play a role in heart development and specification of limb identity. Mutations in this gene have been associated with Holt-Oram syndrome, a developmental disorder affecting the heart and upper limbs. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Heterozygous null mice exhibit strain-dependent perinatal lethality, forelimb and variable congenital heart malformations, whereas homozygous null mice are growth arrested and die by E10.5 of severe heart defects. Hypomorphic mutants show milder defects both in the hetero- and homozygous null state. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	A	13: 63,068,061	H382Q	possibly damaging	Het
A330008L17Rik	C	A	8: 99,421,882		noncoding transcript	Het
Acin1	A	G	14: 54,665,204	V377A	probably benign	Het
Adam39	A	T	8: 40,825,324	I251F	probably damaging	Het
Adnp2	A	T	18: 80,127,697	*1166K	probably null	Het
Akap12	T	A	10: 4,357,574	D1461E	probably benign	Het
Apba1	A	G	19: 23,893,692	D296G	possibly damaging	Het
Apol7a	G	T	15: 77,393,471	L26M	possibly damaging	Het
Bcl2	C	T	1: 106,712,392	M163I	probably damaging	Het
Cap2	T	G	13: 46,531,013	I53R	probably benign	Het
Ccdc105	T	A	10: 78,747,197	K451M	probably damaging	Het
Ccdc74a	T	C	16: 17,650,468	V318A	possibly damaging	Het
Ccnb2	A	G	9: 70,410,788	V234A	probably benign	Het
Cd207	C	T	6: 83,675,597	V184I	probably benign	Het
Cdk12	C	A	11: 98,241,761	C1005*	probably null	Het
Cep83	T	C	10: 94,750,267	S344P	probably damaging	Het
Ces1g	A	T	8: 93,306,954	Y447N	probably benign	Het
Cfap54	A	T	10: 93,048,061	L277Q	probably damaging	Het
Cfh	A	G	1: 140,100,877	Y1027H	probably damaging	Het
Clcnkb	T	A	4: 141,415,214	I28F	possibly damaging	Het
Clec4d	A	G	6: 123,267,109	D59G	probably damaging	Het
Colq	G	A	14: 31,547,452	P153S	probably damaging	Het
Crybg1	T	A	10: 43,986,279	T1500S	probably damaging	Het
Cyp2d34	T	A	15: 82,617,524	R262W	probably damaging	Het
Dennd4b	C	G	3: 90,271,605	L559V	probably damaging	Het
Dhrs1	A	G	14: 55,739,309	V306A	probably benign	Het
Diaph1	A	T	18: 37,854,573	D1043E	possibly damaging	Het
Dis3	G	T	14: 99,086,103	D538E	probably damaging	Het
Dnaic2	T	G	11: 114,750,380	S344A	probably benign	Het
Dner	C	T	1: 84,445,590	V431M	probably damaging	Het
Dnm1l	A	G	16: 16,342,695		probably null	Het
Eps15	T	G	4: 109,312,918	L139*	probably null	Het
Fam193a	T	A	5: 34,466,292	I55N	possibly damaging	Het
Gm10308	T	A	17: 91,088,957	Y102*	probably null	Het
Gm10509	A	G	17: 21,690,855	K30E	possibly damaging	Het
Gm4778	A	T	3: 94,266,218	M174L	probably benign	Het
Gm9573	A	T	17: 35,619,239		probably benign	Het
Gpr155	T	C	2: 73,367,577	M400V	probably benign	Het
H2-M10.2	T	C	17: 36,286,123		probably benign	Het
Heatr1	G	T	13: 12,396,460	A61S	probably benign	Het
Helb	G	T	10: 120,094,242	T744K	probably damaging	Het
Hmcn1	C	A	1: 150,599,030	W4702L	probably damaging	Het
Hmcn2	C	T	2: 31,396,120	R2095W	probably damaging	Het
Igfbp3	G	C	11: 7,208,461	D267E	probably damaging	Het
Ighmbp2	T	A	19: 3,268,669	H469L	probably damaging	Het
Kcnj3	A	C	2: 55,437,220	K7T	probably damaging	Het
Krtap5-5	T	G	7: 142,229,621	K97N	unknown	Het
Lcor	T	C	19: 41,559,266	S430P	probably benign	Het
Lpin1	A	G	12: 16,538,540	V883A	probably damaging	Het
Lrp1b	T	C	2: 41,110,825	Y2243C	probably damaging	Het
Lrrc46	G	A	11: 97,034,730		probably benign	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Mpdz	C	T	4: 81,306,877	V1438M	possibly damaging	Het
Ncbp1	T	A	4: 46,169,131	L635*	probably null	Het
Nipbl	T	C	15: 8,338,551	N1202D	possibly damaging	Het
Nphs1	A	G	7: 30,461,534	D196G	probably benign	Het
Nupl1	A	T	14: 60,244,670		probably benign	Het
Olfr1008	A	G	2: 85,690,083	Y218C	probably damaging	Het
Olfr1360	A	G	13: 21,674,695	I83T	probably benign	Het
Olfr901	A	T	9: 38,430,995	I238F	probably benign	Het
Pax8	A	T	2: 24,435,821	N350K	probably damaging	Het
Pik3cd	T	C	4: 149,658,750	K298E	probably benign	Het
Pkd1	C	T	17: 24,594,485	R4000C	probably damaging	Het
Pkn2	A	T	3: 142,810,727	V546D	possibly damaging	Het
Plcg2	A	G	8: 117,592,708	K673E	probably benign	Het
Pld4	T	G	12: 112,763,392		probably null	Het
Plek	A	T	11: 16,992,901	N130K	probably damaging	Het
Prune2	G	A	19: 17,123,704	D2191N	probably benign	Het
Ptgis	T	C	2: 167,206,803	Y431C	probably damaging	Het
Rhbdf2	T	C	11: 116,607,266	S36G	probably benign	Het
Rtn4ip1	C	T	10: 43,910,830	A178V	probably damaging	Het
Rxfp1	A	G	3: 79,670,881	S168P	probably benign	Het
Sec24a	A	G	11: 51,733,763		probably benign	Het
Shf	G	A	2: 122,368,682	P51S	probably damaging	Het
Slitrk6	C	T	14: 110,750,552	M574I	probably benign	Het
Slk	T	C	19: 47,622,677	F861L	probably damaging	Het
Smpd3	C	A	8: 106,264,971	A317S	probably benign	Het
Spz1	T	A	13: 92,575,125	Q281L	probably damaging	Het
Syde1	T	A	10: 78,586,980	R519S	probably benign	Het
Taf4	T	C	2: 179,976,531	H39R	unknown	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Th	G	A	7: 142,898,166	Q19*	probably null	Het
Tmprss11a	T	A	5: 86,420,179	I230F	probably damaging	Het
Tnfrsf14	T	A	4: 154,925,322	H50L	possibly damaging	Het
Tpp2	T	A	1: 43,978,725		probably null	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trim2	A	G	3: 84,190,800	I398T	possibly damaging	Het
Trpc5	A	T	X: 144,481,226	S212T	probably damaging	Het
Ttn	A	G	2: 76,787,334		probably benign	Het
Unc80	A	G	1: 66,639,248	T2063A	possibly damaging	Het
Usp37	A	T	1: 74,479,655	S260T	probably benign	Het
Vcan	A	G	13: 89,691,681	S1915P	probably benign	Het
Vmn1r33	T	A	6: 66,612,298	I91F	possibly damaging	Het
Zfp422	T	C	6: 116,626,424	T205A	probably benign	Het

Other mutations in Tbx5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01096:Tbx5	APN	5	119883026	missense	probably benign
IGL01595:Tbx5	APN	5	119840838	missense	probably damaging	1.00
IGL01758:Tbx5	APN	5	119844958	unclassified	probably benign
IGL02239:Tbx5	APN	5	119871280	missense	possibly damaging	0.68
IGL02625:Tbx5	APN	5	119836907	utr 5 prime	probably benign
IGL03326:Tbx5	APN	5	119871298	missense	probably damaging	0.99
R0477:Tbx5	UTSW	5	119883119	missense	possibly damaging	0.89
R0485:Tbx5	UTSW	5	119883458	missense	probably benign	0.00
R1218:Tbx5	UTSW	5	119838720	missense	probably damaging	1.00
R2011:Tbx5	UTSW	5	119841906	splice site	probably null
R2125:Tbx5	UTSW	5	119836923	missense	probably benign
R2126:Tbx5	UTSW	5	119836923	missense	probably benign
R2268:Tbx5	UTSW	5	119845109	splice site	probably null
R2302:Tbx5	UTSW	5	119841859	missense	probably damaging	1.00
R4693:Tbx5	UTSW	5	119841899	missense	probably damaging	1.00
R4930:Tbx5	UTSW	5	119883025	missense	probably benign	0.44
R5062:Tbx5	UTSW	5	119836922	missense	probably damaging	0.99
R5245:Tbx5	UTSW	5	119883165	missense	possibly damaging	0.95
R6067:Tbx5	UTSW	5	119883146	missense	probably benign
R6079:Tbx5	UTSW	5	119883146	missense	probably benign
R6138:Tbx5	UTSW	5	119883146	missense	probably benign
R6218:Tbx5	UTSW	5	119853598	missense	probably damaging	1.00
R6528:Tbx5	UTSW	5	119883111	missense	probably damaging	0.97
R6700:Tbx5	UTSW	5	119871397	missense	probably benign	0.30
R6993:Tbx5	UTSW	5	119871389	missense	possibly damaging	0.75
R7777:Tbx5	UTSW	5	119883167	missense	probably benign	0.00
R7801:Tbx5	UTSW	5	119836999	missense	probably benign	0.44
R8056:Tbx5	UTSW	5	119853613	missense	probably benign
U15987:Tbx5	UTSW	5	119883146	missense	probably benign
X0028:Tbx5	UTSW	5	119845119	critical splice donor site	probably null
Z1176:Tbx5	UTSW	5	119883315	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GCGGGAAGTGCCCTTATACACAG -3'
(R):5'- AGCAGCACAATGTCACCTTTCCTC -3'

Sequencing Primer
(F):5'- CTTTTAGATGAAATCACTGGCCC -3'
(R):5'- TGGTTCTAACTAGAAAGCATAGGTG -3'

Posted On

2014-05-23