Incidental Mutation 'R1756:Tbx5'
ID194852
Institutional Source Beutler Lab
Gene Symbol Tbx5
Ensembl Gene ENSMUSG00000018263
Gene NameT-box 5
Synonyms
MMRRC Submission 039788-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R1756 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location119832668-119885219 bp(+) (GRCm38)
Type of Mutationunclassified (3 bp from exon)
DNA Base Change (assembly) A to T at 119845113 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018407] [ENSMUST00000202504] [ENSMUST00000202723]
Predicted Effect probably benign
Transcript: ENSMUST00000018407
AA Change: H220L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000018407
Gene: ENSMUSG00000018263
AA Change: H220L

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
TBOX 53 243 9.61e-129 SMART
low complexity region 381 392 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202504
SMART Domains Protein: ENSMUSP00000143828
Gene: ENSMUSG00000018263

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
TBOX 53 218 6.3e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202723
SMART Domains Protein: ENSMUSP00000144418
Gene: ENSMUSG00000018263

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
TBOX 53 120 3.1e-9 SMART
Meta Mutation Damage Score 0.1082 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 100% (96/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is closely linked to related family member T-box 3 (ulnar mammary syndrome) on human chromosome 12. The encoded protein may play a role in heart development and specification of limb identity. Mutations in this gene have been associated with Holt-Oram syndrome, a developmental disorder affecting the heart and upper limbs. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Heterozygous null mice exhibit strain-dependent perinatal lethality, forelimb and variable congenital heart malformations, whereas homozygous null mice are growth arrested and die by E10.5 of severe heart defects. Hypomorphic mutants show milder defects both in the hetero- and homozygous null state. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,068,061 H382Q possibly damaging Het
A330008L17Rik C A 8: 99,421,882 noncoding transcript Het
Acin1 A G 14: 54,665,204 V377A probably benign Het
Adam39 A T 8: 40,825,324 I251F probably damaging Het
Adnp2 A T 18: 80,127,697 *1166K probably null Het
Akap12 T A 10: 4,357,574 D1461E probably benign Het
Apba1 A G 19: 23,893,692 D296G possibly damaging Het
Apol7a G T 15: 77,393,471 L26M possibly damaging Het
Bcl2 C T 1: 106,712,392 M163I probably damaging Het
Cap2 T G 13: 46,531,013 I53R probably benign Het
Ccdc105 T A 10: 78,747,197 K451M probably damaging Het
Ccdc74a T C 16: 17,650,468 V318A possibly damaging Het
Ccnb2 A G 9: 70,410,788 V234A probably benign Het
Cd207 C T 6: 83,675,597 V184I probably benign Het
Cdk12 C A 11: 98,241,761 C1005* probably null Het
Cep83 T C 10: 94,750,267 S344P probably damaging Het
Ces1g A T 8: 93,306,954 Y447N probably benign Het
Cfap54 A T 10: 93,048,061 L277Q probably damaging Het
Cfh A G 1: 140,100,877 Y1027H probably damaging Het
Clcnkb T A 4: 141,415,214 I28F possibly damaging Het
Clec4d A G 6: 123,267,109 D59G probably damaging Het
Colq G A 14: 31,547,452 P153S probably damaging Het
Crybg1 T A 10: 43,986,279 T1500S probably damaging Het
Cyp2d34 T A 15: 82,617,524 R262W probably damaging Het
Dennd4b C G 3: 90,271,605 L559V probably damaging Het
Dhrs1 A G 14: 55,739,309 V306A probably benign Het
Diaph1 A T 18: 37,854,573 D1043E possibly damaging Het
Dis3 G T 14: 99,086,103 D538E probably damaging Het
Dnaic2 T G 11: 114,750,380 S344A probably benign Het
Dner C T 1: 84,445,590 V431M probably damaging Het
Dnm1l A G 16: 16,342,695 probably null Het
Eps15 T G 4: 109,312,918 L139* probably null Het
Fam193a T A 5: 34,466,292 I55N possibly damaging Het
Gm10308 T A 17: 91,088,957 Y102* probably null Het
Gm10509 A G 17: 21,690,855 K30E possibly damaging Het
Gm4778 A T 3: 94,266,218 M174L probably benign Het
Gm9573 A T 17: 35,619,239 probably benign Het
Gpr155 T C 2: 73,367,577 M400V probably benign Het
H2-M10.2 T C 17: 36,286,123 probably benign Het
Heatr1 G T 13: 12,396,460 A61S probably benign Het
Helb G T 10: 120,094,242 T744K probably damaging Het
Hmcn1 C A 1: 150,599,030 W4702L probably damaging Het
Hmcn2 C T 2: 31,396,120 R2095W probably damaging Het
Igfbp3 G C 11: 7,208,461 D267E probably damaging Het
Ighmbp2 T A 19: 3,268,669 H469L probably damaging Het
Kcnj3 A C 2: 55,437,220 K7T probably damaging Het
Krtap5-5 T G 7: 142,229,621 K97N unknown Het
Lcor T C 19: 41,559,266 S430P probably benign Het
Lpin1 A G 12: 16,538,540 V883A probably damaging Het
Lrp1b T C 2: 41,110,825 Y2243C probably damaging Het
Lrrc46 G A 11: 97,034,730 probably benign Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mpdz C T 4: 81,306,877 V1438M possibly damaging Het
Ncbp1 T A 4: 46,169,131 L635* probably null Het
Nipbl T C 15: 8,338,551 N1202D possibly damaging Het
Nphs1 A G 7: 30,461,534 D196G probably benign Het
Nupl1 A T 14: 60,244,670 probably benign Het
Olfr1008 A G 2: 85,690,083 Y218C probably damaging Het
Olfr1360 A G 13: 21,674,695 I83T probably benign Het
Olfr901 A T 9: 38,430,995 I238F probably benign Het
Pax8 A T 2: 24,435,821 N350K probably damaging Het
Pik3cd T C 4: 149,658,750 K298E probably benign Het
Pkd1 C T 17: 24,594,485 R4000C probably damaging Het
Pkn2 A T 3: 142,810,727 V546D possibly damaging Het
Plcg2 A G 8: 117,592,708 K673E probably benign Het
Pld4 T G 12: 112,763,392 probably null Het
Plek A T 11: 16,992,901 N130K probably damaging Het
Prune2 G A 19: 17,123,704 D2191N probably benign Het
Ptgis T C 2: 167,206,803 Y431C probably damaging Het
Rhbdf2 T C 11: 116,607,266 S36G probably benign Het
Rtn4ip1 C T 10: 43,910,830 A178V probably damaging Het
Rxfp1 A G 3: 79,670,881 S168P probably benign Het
Sec24a A G 11: 51,733,763 probably benign Het
Shf G A 2: 122,368,682 P51S probably damaging Het
Slitrk6 C T 14: 110,750,552 M574I probably benign Het
Slk T C 19: 47,622,677 F861L probably damaging Het
Smpd3 C A 8: 106,264,971 A317S probably benign Het
Spz1 T A 13: 92,575,125 Q281L probably damaging Het
Syde1 T A 10: 78,586,980 R519S probably benign Het
Taf4 T C 2: 179,976,531 H39R unknown Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Th G A 7: 142,898,166 Q19* probably null Het
Tmprss11a T A 5: 86,420,179 I230F probably damaging Het
Tnfrsf14 T A 4: 154,925,322 H50L possibly damaging Het
Tpp2 T A 1: 43,978,725 probably null Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trim2 A G 3: 84,190,800 I398T possibly damaging Het
Trpc5 A T X: 144,481,226 S212T probably damaging Het
Ttn A G 2: 76,787,334 probably benign Het
Unc80 A G 1: 66,639,248 T2063A possibly damaging Het
Usp37 A T 1: 74,479,655 S260T probably benign Het
Vcan A G 13: 89,691,681 S1915P probably benign Het
Vmn1r33 T A 6: 66,612,298 I91F possibly damaging Het
Zfp422 T C 6: 116,626,424 T205A probably benign Het
Other mutations in Tbx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Tbx5 APN 5 119883026 missense probably benign
IGL01595:Tbx5 APN 5 119840838 missense probably damaging 1.00
IGL01758:Tbx5 APN 5 119844958 unclassified probably benign
IGL02239:Tbx5 APN 5 119871280 missense possibly damaging 0.68
IGL02625:Tbx5 APN 5 119836907 utr 5 prime probably benign
IGL03326:Tbx5 APN 5 119871298 missense probably damaging 0.99
R0477:Tbx5 UTSW 5 119883119 missense possibly damaging 0.89
R0485:Tbx5 UTSW 5 119883458 missense probably benign 0.00
R1218:Tbx5 UTSW 5 119838720 missense probably damaging 1.00
R2011:Tbx5 UTSW 5 119841906 splice site probably null
R2125:Tbx5 UTSW 5 119836923 missense probably benign
R2126:Tbx5 UTSW 5 119836923 missense probably benign
R2268:Tbx5 UTSW 5 119845109 splice site probably null
R2302:Tbx5 UTSW 5 119841859 missense probably damaging 1.00
R4693:Tbx5 UTSW 5 119841899 missense probably damaging 1.00
R4930:Tbx5 UTSW 5 119883025 missense probably benign 0.44
R5062:Tbx5 UTSW 5 119836922 missense probably damaging 0.99
R5245:Tbx5 UTSW 5 119883165 missense possibly damaging 0.95
R6067:Tbx5 UTSW 5 119883146 missense probably benign
R6079:Tbx5 UTSW 5 119883146 missense probably benign
R6138:Tbx5 UTSW 5 119883146 missense probably benign
R6218:Tbx5 UTSW 5 119853598 missense probably damaging 1.00
R6528:Tbx5 UTSW 5 119883111 missense probably damaging 0.97
R6700:Tbx5 UTSW 5 119871397 missense probably benign 0.30
R6993:Tbx5 UTSW 5 119871389 missense possibly damaging 0.75
R7777:Tbx5 UTSW 5 119883167 missense probably benign 0.00
R7801:Tbx5 UTSW 5 119836999 missense probably benign 0.44
R8056:Tbx5 UTSW 5 119853613 missense probably benign
U15987:Tbx5 UTSW 5 119883146 missense probably benign
X0028:Tbx5 UTSW 5 119845119 critical splice donor site probably null
Z1176:Tbx5 UTSW 5 119883315 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCGGGAAGTGCCCTTATACACAG -3'
(R):5'- AGCAGCACAATGTCACCTTTCCTC -3'

Sequencing Primer
(F):5'- CTTTTAGATGAAATCACTGGCCC -3'
(R):5'- TGGTTCTAACTAGAAAGCATAGGTG -3'
Posted On2014-05-23