Incidental Mutation 'RF058:Gab3'
ID605343
Institutional Source Beutler Lab
Gene Symbol Gab3
Ensembl Gene ENSMUSG00000032750
Gene Namegrowth factor receptor bound protein 2-associated protein 3
Synonyms5930433H21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF058 (G1)
Quality Score165.468
Status Not validated
ChromosomeX
Chromosomal Location74966843-75085458 bp(-) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) TCT to TCTACT at 75000002 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037374] [ENSMUST00000114104] [ENSMUST00000114109]
Predicted Effect probably benign
Transcript: ENSMUST00000037374
SMART Domains Protein: ENSMUSP00000041951
Gene: ENSMUSG00000032750

DomainStartEndE-ValueType
PH 6 119 3.2e-21 SMART
low complexity region 269 280 N/A INTRINSIC
low complexity region 307 314 N/A INTRINSIC
low complexity region 424 435 N/A INTRINSIC
coiled coil region 494 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114104
SMART Domains Protein: ENSMUSP00000109739
Gene: ENSMUSG00000032750

DomainStartEndE-ValueType
PH 6 119 3.2e-21 SMART
low complexity region 269 280 N/A INTRINSIC
low complexity region 307 314 N/A INTRINSIC
low complexity region 424 435 N/A INTRINSIC
coiled coil region 495 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114109
SMART Domains Protein: ENSMUSP00000109744
Gene: ENSMUSG00000032750

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
coiled coil region 97 123 N/A INTRINSIC
Pfam:Pcc1 170 228 1.1e-9 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the GRB2-associated binding protein gene family. These proteins are scaffolding/docking proteins that are involved in several growth factor and cytokine signaling pathways, and they contain a pleckstrin homology domain, and bind SHP2 tyrosine phosphatase and GRB2 adapter protein. The protein encoded by this gene facilitates macrophage differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Females homozygous and males hemizygous for disruptions in this X-linked gene developed normally, exhibted normal hematopoiesis, and were immunocompetent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110021N24Rik GAGCGCGGCC G 4: 108,780,629 probably benign Het
5430401F13Rik AAGGAAAAGGTGGCCAG AAGGAAAAGGTGGCCAGCAAAAACAGAGAGGAAAAGGTGGCCAG 6: 131,552,887 probably benign Het
5430401F13Rik CAG CAGCAAAAACAGAAAGGAAAAGGTGGCCAG 6: 131,552,901 probably benign Het
Alg9 GGC GGCTGC 9: 50,775,427 probably benign Het
Arid1b CGGGGG CGGGGGGGG 17: 4,995,583 probably benign Het
Chd4 GC GCTCCCTC 6: 125,122,131 probably benign Het
Chga CAG CAGAAG 12: 102,561,416 probably benign Het
Cort GCCCACTCGT G 4: 149,125,412 probably benign Het
Flywch1 GT GTGGGGAGGCTACGTGCTCACCCGCTCCTGGTAT 17: 23,762,177 probably null Het
Gabre C CCGGCTG X: 72,270,063 probably benign Het
Haus4 CACTTAAAAAAAAAA CA 14: 54,550,035 probably benign Het
Il2 AG AGGGCTTGAAGTGG 3: 37,125,817 probably benign Het
Il2 CTTGAAGTGG CTTGAAGTGGGGATTGAAGTGG 3: 37,125,821 probably benign Het
Kri1 TCCTCCTCC TC 9: 21,281,066 probably null Het
Krtap28-10 ACAGCCACCACAGCCACAGCCACCACAGC ACAGCCACCACAGCCCCAGCCACCACAGCCACAGCCACCACAGC 1: 83,042,262 probably benign Het
Mbd1 CGTCTTCGTCTGCATCTGCATCTGCA C 18: 74,273,609 probably null Het
Nefh CCTC CCTCGCCTGGGGACTTGGACTC 11: 4,941,021 probably benign Het
Rtbdn GCAGCG GCAGCGACAGCG 8: 84,956,172 probably benign Het
Setd1a GTGGTGGT GTGGTGGTATTGGTGGT 7: 127,785,318 probably benign Het
Treml1 ACCT A 17: 48,359,947 probably null Het
Triobp CTCCCTGTGCCCAAC CTCCCTGTGCCCAACTGAACAACCCCAGGATTCCCTGTGCCCAAC 15: 78,967,044 probably benign Het
Zfp598 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC 17: 24,680,761 probably benign Het
Other mutations in Gab3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Gab3 APN X 75005359 missense probably benign 0.00
R0894:Gab3 UTSW X 75033418 missense probably damaging 1.00
R2069:Gab3 UTSW X 75000095 missense probably damaging 1.00
R2102:Gab3 UTSW X 74999979 small insertion probably benign
RF001:Gab3 UTSW X 75000018 small insertion probably benign
RF003:Gab3 UTSW X 75000006 nonsense probably null
RF006:Gab3 UTSW X 75000027 small insertion probably benign
RF007:Gab3 UTSW X 74999996 small insertion probably benign
RF007:Gab3 UTSW X 75000011 small insertion probably benign
RF007:Gab3 UTSW X 75000025 small insertion probably benign
RF009:Gab3 UTSW X 74999992 small insertion probably benign
RF009:Gab3 UTSW X 75000024 nonsense probably null
RF010:Gab3 UTSW X 75000011 small insertion probably benign
RF012:Gab3 UTSW X 75000020 small insertion probably benign
RF016:Gab3 UTSW X 74999985 nonsense probably null
RF020:Gab3 UTSW X 75000017 small insertion probably benign
RF022:Gab3 UTSW X 74999994 nonsense probably null
RF025:Gab3 UTSW X 75000008 small insertion probably benign
RF026:Gab3 UTSW X 74999990 small insertion probably benign
RF026:Gab3 UTSW X 75000023 small insertion probably benign
RF028:Gab3 UTSW X 75000000 nonsense probably null
RF028:Gab3 UTSW X 75000017 small insertion probably benign
RF030:Gab3 UTSW X 74999977 small deletion probably benign
RF030:Gab3 UTSW X 75000005 small insertion probably benign
RF030:Gab3 UTSW X 75000008 small insertion probably benign
RF030:Gab3 UTSW X 75000025 small insertion probably benign
RF030:Gab3 UTSW X 75000026 small insertion probably benign
RF031:Gab3 UTSW X 74999996 small insertion probably benign
RF031:Gab3 UTSW X 74999997 nonsense probably null
RF031:Gab3 UTSW X 75000001 small insertion probably benign
RF033:Gab3 UTSW X 75000001 small insertion probably benign
RF033:Gab3 UTSW X 75000023 small insertion probably benign
RF039:Gab3 UTSW X 75000004 small insertion probably benign
RF040:Gab3 UTSW X 75000027 small insertion probably benign
RF042:Gab3 UTSW X 75000005 small insertion probably benign
RF042:Gab3 UTSW X 75000022 small insertion probably benign
RF044:Gab3 UTSW X 75000005 small insertion probably benign
RF047:Gab3 UTSW X 74999993 small insertion probably benign
RF052:Gab3 UTSW X 74999983 small insertion probably benign
RF055:Gab3 UTSW X 74999987 small insertion probably benign
RF055:Gab3 UTSW X 75000010 small insertion probably benign
RF059:Gab3 UTSW X 74999990 small insertion probably benign
RF060:Gab3 UTSW X 75000013 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CGGTGACCTGGTTTTATAATAAGC -3'
(R):5'- TTTGGAAGGAACAGGCTCAAAC -3'

Sequencing Primer
(F):5'- AAGCCATTCTTTATGACTGCACAC -3'
(R):5'- GGCTCAAACCCCACAGG -3'
Posted On2019-12-04