Incidental Mutation 'RF058:5430401F13Rik'
ID 605328
Institutional Source Beutler Lab
Gene Symbol 5430401F13Rik
Ensembl Gene ENSMUSG00000094113
Gene Name RIKEN cDNA 5430401F13 gene
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # RF058 (G1)
Quality Score 197.468
Status Not validated
Chromosome 6
Chromosomal Location 131520725-131530720 bp(+) (GRCm39)
Type of Mutation small insertion (9 aa in frame mutation)
DNA Base Change (assembly) CAG to CAGCAAAAACAGAAAGGAAAAGGTGGCCAG at 131529864 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075020] [ENSMUST00000161385]
AlphaFold E9Q328
Predicted Effect probably benign
Transcript: ENSMUST00000075020
SMART Domains Protein: ENSMUSP00000074539
Gene: ENSMUSG00000094113

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 100 116 N/A INTRINSIC
low complexity region 118 166 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161385
SMART Domains Protein: ENSMUSP00000125129
Gene: ENSMUSG00000094113

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 100 116 N/A INTRINSIC
low complexity region 118 166 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110021N24Rik GAGCGCGGCC G 4: 108,637,826 (GRCm39) probably benign Het
Alg9 GGC GGCTGC 9: 50,686,727 (GRCm39) probably benign Het
Arid1b CGGGGG CGGGGGGGG 17: 5,045,858 (GRCm39) probably benign Het
Chd4 GC GCTCCCTC 6: 125,099,094 (GRCm39) probably benign Het
Chga CAG CAGAAG 12: 102,527,675 (GRCm39) probably benign Het
Cort GCCCACTCGT G 4: 149,209,869 (GRCm39) probably benign Het
Flywch1 GT GTGGGGAGGCTACGTGCTCACCCGCTCCTGGTAT 17: 23,981,151 (GRCm39) probably null Het
Gab3 TCT TCTACT X: 74,043,608 (GRCm39) probably benign Het
Gabre C CCGGCTG X: 71,313,669 (GRCm39) probably benign Het
Haus4 CACTTAAAAAAAAAA CA 14: 54,787,492 (GRCm39) probably benign Het
Il2 AG AGGGCTTGAAGTGG 3: 37,179,966 (GRCm39) probably benign Het
Il2 CTTGAAGTGG CTTGAAGTGGGGATTGAAGTGG 3: 37,179,970 (GRCm39) probably benign Het
Kri1 TCCTCCTCC TC 9: 21,192,362 (GRCm39) probably null Het
Krtap28-10 ACAGCCACCACAGCCACAGCCACCACAGC ACAGCCACCACAGCCCCAGCCACCACAGCCACAGCCACCACAGC 1: 83,019,983 (GRCm39) probably benign Het
Mbd1 CGTCTTCGTCTGCATCTGCATCTGCA C 18: 74,406,680 (GRCm39) probably null Het
Nefh CCTC CCTCGCCTGGGGACTTGGACTC 11: 4,891,021 (GRCm39) probably benign Het
Rtbdn GCAGCG GCAGCGACAGCG 8: 85,682,801 (GRCm39) probably benign Het
Setd1a GTGGTGGT GTGGTGGTATTGGTGGT 7: 127,384,490 (GRCm39) probably benign Het
Treml1 ACCT A 17: 48,666,975 (GRCm39) probably null Het
Triobp CTCCCTGTGCCCAAC CTCCCTGTGCCCAACTGAACAACCCCAGGATTCCCTGTGCCCAAC 15: 78,851,244 (GRCm39) probably benign Het
Zfp598 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC 17: 24,899,735 (GRCm39) probably benign Het
Other mutations in 5430401F13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02737:5430401F13Rik APN 6 131,529,555 (GRCm39) missense probably benign 0.14
R0866:5430401F13Rik UTSW 6 131,529,742 (GRCm39) missense unknown
R1674:5430401F13Rik UTSW 6 131,529,766 (GRCm39) missense unknown
R6374:5430401F13Rik UTSW 6 131,529,892 (GRCm39) missense unknown
R6671:5430401F13Rik UTSW 6 131,528,313 (GRCm39) critical splice donor site probably null
R7150:5430401F13Rik UTSW 6 131,529,630 (GRCm39) missense probably benign 0.16
RF005:5430401F13Rik UTSW 6 131,529,847 (GRCm39) small insertion probably benign
RF014:5430401F13Rik UTSW 6 131,529,820 (GRCm39) small insertion probably benign
RF015:5430401F13Rik UTSW 6 131,529,819 (GRCm39) small insertion probably benign
RF015:5430401F13Rik UTSW 6 131,529,822 (GRCm39) small insertion probably benign
RF015:5430401F13Rik UTSW 6 131,529,824 (GRCm39) small insertion probably benign
RF023:5430401F13Rik UTSW 6 131,529,818 (GRCm39) small insertion probably benign
RF023:5430401F13Rik UTSW 6 131,529,841 (GRCm39) small insertion probably benign
RF029:5430401F13Rik UTSW 6 131,529,858 (GRCm39) small insertion probably benign
RF037:5430401F13Rik UTSW 6 131,529,851 (GRCm39) small insertion probably benign
RF037:5430401F13Rik UTSW 6 131,529,850 (GRCm39) small insertion probably benign
RF041:5430401F13Rik UTSW 6 131,529,855 (GRCm39) small insertion probably benign
RF041:5430401F13Rik UTSW 6 131,529,836 (GRCm39) small insertion probably benign
RF041:5430401F13Rik UTSW 6 131,529,857 (GRCm39) small insertion probably benign
RF042:5430401F13Rik UTSW 6 131,529,849 (GRCm39) small insertion probably benign
RF058:5430401F13Rik UTSW 6 131,529,850 (GRCm39) small insertion probably benign
RF063:5430401F13Rik UTSW 6 131,529,846 (GRCm39) small insertion probably benign
RF063:5430401F13Rik UTSW 6 131,529,847 (GRCm39) small insertion probably benign
X0062:5430401F13Rik UTSW 6 131,529,601 (GRCm39) missense probably benign 0.29
Z1177:5430401F13Rik UTSW 6 131,529,684 (GRCm39) missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AGTCCAGGATCACCAGAGTG -3'
(R):5'- ACTTGCTGCTGTGAGAAGGG -3'

Sequencing Primer
(F):5'- TCCAGGATCACCAGAGTGGAAATG -3'
(R):5'- TTAAATGCTAGGTGGTGAGAATGGC -3'
Posted On 2019-12-04