Mutagenetix > Incidental Mutation

Incidental Mutation 'RF058:Triobp'

605336

Institutional Source

Beutler Lab

Gene Symbol

Triobp

Ensembl Gene

ENSMUSG00000033088

Gene Name

TRIO and F-actin binding protein

Synonyms

EST478828, Mus EST 478828, Tara

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

RF058 (G1)

Quality Score

217.468

Status

Not validated

Chromosome

Chromosomal Location

78947724-79005869 bp(+) (GRCm38)

Type of Mutation

small insertion (10 aa in frame mutation)

DNA Base Change (assembly)

CTCCCTGTGCCCAAC to CTCCCTGTGCCCAACTGAACAACCCCAGGATTCCCTGTGCCCAAC at 78967044 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000155397 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000140228]

AlphaFold

Q99KW3

Predicted Effect

probably benign
Transcript: ENSMUST00000109689

SMART Domains

Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088

Domain	Start	End	E-Value	Type
low complexity region	130	154	N/A	INTRINSIC
low complexity region	291	311	N/A	INTRINSIC
internal_repeat_1	312	394	7.43e-13	PROSPERO
internal_repeat_1	390	540	7.43e-13	PROSPERO
low complexity region	585	600	N/A	INTRINSIC
low complexity region	638	657	N/A	INTRINSIC
low complexity region	697	729	N/A	INTRINSIC
low complexity region	767	777	N/A	INTRINSIC
low complexity region	885	901	N/A	INTRINSIC
low complexity region	903	923	N/A	INTRINSIC
low complexity region	995	1017	N/A	INTRINSIC
low complexity region	1054	1068	N/A	INTRINSIC
low complexity region	1221	1235	N/A	INTRINSIC
PH	1395	1492	6.2e-19	SMART
coiled coil region	1665	1692	N/A	INTRINSIC
coiled coil region	1727	1765	N/A	INTRINSIC
coiled coil region	1789	1851	N/A	INTRINSIC
coiled coil region	1885	1964	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109690

SMART Domains

Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088

Domain	Start	End	E-Value	Type
low complexity region	130	154	N/A	INTRINSIC
low complexity region	291	311	N/A	INTRINSIC
internal_repeat_1	312	394	9.24e-13	PROSPERO
internal_repeat_1	390	540	9.24e-13	PROSPERO
low complexity region	585	600	N/A	INTRINSIC
low complexity region	638	657	N/A	INTRINSIC
low complexity region	697	729	N/A	INTRINSIC
low complexity region	767	777	N/A	INTRINSIC
low complexity region	885	901	N/A	INTRINSIC
low complexity region	903	923	N/A	INTRINSIC
low complexity region	995	1017	N/A	INTRINSIC
low complexity region	1054	1068	N/A	INTRINSIC
low complexity region	1221	1235	N/A	INTRINSIC
PH	1441	1538	6.2e-19	SMART
coiled coil region	1711	1738	N/A	INTRINSIC
coiled coil region	1773	1811	N/A	INTRINSIC
coiled coil region	1835	1897	N/A	INTRINSIC
coiled coil region	1931	2010	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140228

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 99.3%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 22 list
Gene	Ref	Var	Chr/Loc	Predicted Effect	Zygosity
3110021N24Rik	GAGCGCGGCC	G	4: 108,780,629	probably benign	Het
5430401F13Rik	AAGGAAAAGGTGGCCAG	AAGGAAAAGGTGGCCAGCAAAAACAGAGAGGAAAAGGTGGCCAG	6: 131,552,887	probably benign	Het
5430401F13Rik	CAG	CAGCAAAAACAGAAAGGAAAAGGTGGCCAG	6: 131,552,901	probably benign	Het
Alg9	GGC	GGCTGC	9: 50,775,427	probably benign	Het
Arid1b	CGGGGG	CGGGGGGGG	17: 4,995,583	probably benign	Het
Chd4	GC	GCTCCCTC	6: 125,122,131	probably benign	Het
Chga	CAG	CAGAAG	12: 102,561,416	probably benign	Het
Cort	GCCCACTCGT	G	4: 149,125,412	probably benign	Het
Flywch1	GT	GTGGGGAGGCTACGTGCTCACCCGCTCCTGGTAT	17: 23,762,177	probably null	Het
Gab3	TCT	TCTACT	X: 75,000,002	probably benign	Het
Gabre	C	CCGGCTG	X: 72,270,063	probably benign	Het
Haus4	CACTTAAAAAAAAAA	CA	14: 54,550,035	probably benign	Het
Il2	AG	AGGGCTTGAAGTGG	3: 37,125,817	probably benign	Het
Il2	CTTGAAGTGG	CTTGAAGTGGGGATTGAAGTGG	3: 37,125,821	probably benign	Het
Kri1	TCCTCCTCC	TC	9: 21,281,066	probably null	Het
Krtap28-10	ACAGCCACCACAGCCACAGCCACCACAGC	ACAGCCACCACAGCCCCAGCCACCACAGCCACAGCCACCACAGC	1: 83,042,262	probably benign	Het
Mbd1	CGTCTTCGTCTGCATCTGCATCTGCA	C	18: 74,273,609	probably null	Het
Nefh	CCTC	CCTCGCCTGGGGACTTGGACTC	11: 4,941,021	probably benign	Het
Rtbdn	GCAGCG	GCAGCGACAGCG	8: 84,956,172	probably benign	Het
Setd1a	GTGGTGGT	GTGGTGGTATTGGTGGT	7: 127,785,318	probably benign	Het
Treml1	ACCT	A	17: 48,359,947	probably null	Het
Zfp598	CCCACCACCACAACCACCACCACCACCACCAC	CCCACCACCACCACCACAACCACCACCACCACCACCAC	17: 24,680,761	probably benign	Het

Other mutations in Triobp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01634:Triobp	APN	15	78993368	missense	probably damaging	1.00
IGL01904:Triobp	APN	15	78967364	missense	possibly damaging	0.80
IGL01957:Triobp	APN	15	78972647	critical splice donor site	probably null
IGL02085:Triobp	APN	15	78974297	splice site	probably benign
IGL02260:Triobp	APN	15	78966362	missense	probably benign	0.00
IGL02498:Triobp	APN	15	78961043	missense	probably benign	0.01
IGL02551:Triobp	APN	15	78973489	missense	probably benign
IGL02740:Triobp	APN	15	78966689	missense	probably benign	0.21
IGL02810:Triobp	APN	15	79002203	missense	possibly damaging	0.95
IGL03063:Triobp	APN	15	78990884	missense	probably damaging	1.00
FR4304:Triobp	UTSW	15	78993387	unclassified	probably benign
FR4340:Triobp	UTSW	15	78993390	unclassified	probably benign
FR4342:Triobp	UTSW	15	78993392	unclassified	probably benign
FR4449:Triobp	UTSW	15	78993389	unclassified	probably benign
FR4548:Triobp	UTSW	15	78993387	unclassified	probably benign
FR4548:Triobp	UTSW	15	78993390	unclassified	probably benign
R0276:Triobp	UTSW	15	78973676	missense	probably benign	0.09
R0309:Triobp	UTSW	15	78976540	missense	probably damaging	1.00
R0433:Triobp	UTSW	15	78968201	missense	possibly damaging	0.69
R0464:Triobp	UTSW	15	78966986	missense	possibly damaging	0.71
R0525:Triobp	UTSW	15	78973898	missense	possibly damaging	0.93
R0665:Triobp	UTSW	15	78973898	missense	possibly damaging	0.93
R0689:Triobp	UTSW	15	78959988	nonsense	probably null
R1149:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1149:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1151:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1152:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1510:Triobp	UTSW	15	79003767	missense	probably damaging	1.00
R1519:Triobp	UTSW	15	78973738	missense	probably benign	0.00
R1642:Triobp	UTSW	15	79002148	missense	probably damaging	1.00
R1732:Triobp	UTSW	15	78967228	missense	possibly damaging	0.69
R1755:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1975:Triobp	UTSW	15	78966708	missense	probably benign
R2051:Triobp	UTSW	15	79004540	missense	probably damaging	1.00
R2073:Triobp	UTSW	15	78973895	missense	probably damaging	0.99
R2260:Triobp	UTSW	15	78991440	critical splice donor site	probably null
R2351:Triobp	UTSW	15	79004580	missense	probably benign	0.09
R2902:Triobp	UTSW	15	78973418	missense	possibly damaging	0.90
R3801:Triobp	UTSW	15	78973700	missense	probably benign	0.04
R3959:Triobp	UTSW	15	79002389	nonsense	probably null
R4003:Triobp	UTSW	15	78959977	unclassified	probably benign
R4084:Triobp	UTSW	15	78973671	missense	probably benign	0.19
R4482:Triobp	UTSW	15	78966563	missense	possibly damaging	0.87
R4592:Triobp	UTSW	15	78967095	missense	probably benign
R4662:Triobp	UTSW	15	78993269	missense	probably damaging	1.00
R4732:Triobp	UTSW	15	78967113	missense	probably damaging	0.99
R4733:Triobp	UTSW	15	78967113	missense	probably damaging	0.99
R4789:Triobp	UTSW	15	78991028	missense	probably damaging	1.00
R4968:Triobp	UTSW	15	78966616	missense	probably benign	0.03
R4990:Triobp	UTSW	15	78967005	missense	probably benign	0.00
R5129:Triobp	UTSW	15	78961096	missense	probably benign	0.15
R5181:Triobp	UTSW	15	78967754	missense	probably benign	0.00
R5279:Triobp	UTSW	15	78994391	missense	possibly damaging	0.66
R5584:Triobp	UTSW	15	78968132	missense	possibly damaging	0.89
R5601:Triobp	UTSW	15	78973633	missense	probably damaging	1.00
R5810:Triobp	UTSW	15	78968267	missense	probably benign	0.07
R5969:Triobp	UTSW	15	78967540	missense	probably benign	0.05
R6722:Triobp	UTSW	15	79001565	missense	probably damaging	1.00
R6739:Triobp	UTSW	15	78966366	missense	possibly damaging	0.77
R6810:Triobp	UTSW	15	78966615	missense	possibly damaging	0.47
R7011:Triobp	UTSW	15	78978723	missense	probably damaging	0.98
R7015:Triobp	UTSW	15	78994060	missense	probably damaging	0.99
R7200:Triobp	UTSW	15	78966842	small deletion	probably benign
R7294:Triobp	UTSW	15	78973976	missense	probably damaging	0.99
R7688:Triobp	UTSW	15	78961111	splice site	probably null
R7805:Triobp	UTSW	15	78974004	missense	probably benign	0.37
R7972:Triobp	UTSW	15	78967986	missense	probably damaging	1.00
R7977:Triobp	UTSW	15	79001544	missense	probably damaging	1.00
R7987:Triobp	UTSW	15	79001544	missense	probably damaging	1.00
R7999:Triobp	UTSW	15	78959944	missense	probably damaging	0.99
R8344:Triobp	UTSW	15	78958275	missense	possibly damaging	0.67
R8348:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8446:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8448:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8469:Triobp	UTSW	15	78967019	missense	probably benign	0.00
R8491:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8492:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8493:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R9424:Triobp	UTSW	15	78960066	missense	probably damaging	1.00
R9495:Triobp	UTSW	15	78993178	missense	probably damaging	1.00
R9514:Triobp	UTSW	15	78993178	missense	probably damaging	1.00
R9530:Triobp	UTSW	15	79002121	missense	probably damaging	1.00
R9550:Triobp	UTSW	15	78973877	missense	probably damaging	1.00
R9576:Triobp	UTSW	15	78960066	missense	probably damaging	1.00
R9646:Triobp	UTSW	15	79003734	missense	probably damaging	1.00
RF001:Triobp	UTSW	15	78967027	small insertion	probably benign
RF005:Triobp	UTSW	15	78967061	small insertion	probably benign
RF007:Triobp	UTSW	15	78967044	small insertion	probably benign
RF022:Triobp	UTSW	15	78974282	missense	probably benign	0.05
RF028:Triobp	UTSW	15	78967039	small insertion	probably benign
RF032:Triobp	UTSW	15	78967036	small insertion	probably benign
RF035:Triobp	UTSW	15	78967039	small insertion	probably benign
RF039:Triobp	UTSW	15	78967036	small insertion	probably benign
RF039:Triobp	UTSW	15	78967039	small insertion	probably benign
RF040:Triobp	UTSW	15	78967063	small insertion	probably benign
RF049:Triobp	UTSW	15	78967061	small insertion	probably benign
RF051:Triobp	UTSW	15	78967034	small insertion	probably benign
X0026:Triobp	UTSW	15	78960023	missense	possibly damaging	0.94
Z1177:Triobp	UTSW	15	79002181	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACCCTAGGACTCCCTGTAC -3'
(R):5'- AGATGCTCCCATTTGCTGC -3'

Sequencing Primer
(F):5'- TAGGACTCCCTGTACCCAGAG -3'
(R):5'- TCCCATTTGCTGCAGGAAG -3'

Posted On

2019-12-04