Incidental Mutation 'R1691:Pcsk1'
ID 191822
Institutional Source Beutler Lab
Gene Symbol Pcsk1
Ensembl Gene ENSMUSG00000021587
Gene Name proprotein convertase subtilisin/kexin type 1
Synonyms PC3, PC1, Nec-1, SPC3, prohormone convertase 1/3, Nec1, Phpp-1
MMRRC Submission 039724-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1691 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 75089826-75134861 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75132225 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 723 (D723G)
Ref Sequence ENSEMBL: ENSMUSP00000022075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022075]
AlphaFold P63239
PDB Structure Solution Structure of the Mouse Prohormone Convertase 1 Pro-Domain [SOLUTION NMR]
PC1/3 DCSG sorting domain structure in DPC [SOLUTION NMR]
PC1/3 DCSG sorting domain in CHAPS [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022075
AA Change: D723G

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000022075
Gene: ENSMUSG00000021587
AA Change: D723G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:S8_pro-domain 34 110 6.4e-26 PFAM
Pfam:Peptidase_S8 158 442 2.2e-49 PFAM
Pfam:P_proprotein 504 591 6.1e-30 PFAM
low complexity region 679 694 N/A INTRINSIC
Pfam:Proho_convert 713 751 4.3e-26 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to subcellular compartments where a second autocatalytic even takes place and the catalytic activity is acquired. The protease is packaged into and activated in dense core secretory granules and expressed in the neuroendocrine system and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It functions in the proteolytic activation of polypeptide hormones and neuropeptides precursors. Mutations in this gene have been associated with susceptibility to obesity and proprotein convertase 1/3 deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele show pre- and postnatal death, low weight, diarrhea, hypoglycemia, low insulin and GHRH levels, and lack mature glucagon and ACTH levels. Homozygotes for another null allele die prior to implantation. ENU mutants show obesity, polyphagia and higher metabolic efficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T C 7: 82,499,606 S283P probably damaging Het
Adck2 T A 6: 39,574,968 L223* probably null Het
Ank T C 15: 27,590,944 W390R probably damaging Het
Ano5 T C 7: 51,590,579 Y752H probably damaging Het
Apcs T A 1: 172,894,593 D62V probably damaging Het
Atad5 A G 11: 80,095,532 T482A probably benign Het
Atp7b A G 8: 22,011,023 Y955H possibly damaging Het
Ccdc13 A T 9: 121,825,068 probably null Het
Ccdc157 G A 11: 4,149,030 P159S probably benign Het
Cdhr3 C T 12: 33,082,247 V126M probably damaging Het
Cdr1 T C X: 61,184,174 D462G possibly damaging Het
Cisd1 A G 10: 71,344,729 V9A probably benign Het
Col19a1 T C 1: 24,536,941 R107G unknown Het
Col1a2 C A 6: 4,536,038 H972Q unknown Het
Col3a1 T A 1: 45,348,616 probably benign Het
Dbnl A G 11: 5,797,174 S235G probably null Het
Dock4 T A 12: 40,725,755 S566T probably benign Het
Efcab6 T C 15: 83,933,206 D722G probably benign Het
Esyt1 T C 10: 128,525,534 Q97R probably benign Het
Fam196a C T 7: 134,918,286 A172T probably damaging Het
Fat2 G A 11: 55,311,852 T132I probably damaging Het
Fgd2 C T 17: 29,378,944 Q618* probably null Het
Flnc T A 6: 29,441,214 V389E probably benign Het
Garnl3 A T 2: 32,997,663 Y778* probably null Het
Gpaa1 A T 15: 76,332,216 Y45F probably damaging Het
Grid1 A T 14: 35,452,329 I643F probably damaging Het
Gsdmc2 T C 15: 63,833,465 D133G probably damaging Het
Hp T C 8: 109,575,572 D248G probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ifna13 T C 4: 88,644,054 D111G probably benign Het
Il9r T A 11: 32,191,829 Q309L possibly damaging Het
Ints1 A T 5: 139,768,932 D617E probably damaging Het
Kcnj12 A T 11: 61,070,277 N467I possibly damaging Het
Kmt2e T A 5: 23,464,849 D111E probably damaging Het
Lama4 A G 10: 39,080,563 K1161E probably benign Het
Lamc1 C T 1: 153,247,249 D732N probably benign Het
Larp1 A G 11: 58,048,048 T517A probably benign Het
Lrp12 A G 15: 39,872,265 I757T probably damaging Het
Max T C 12: 76,953,272 D23G possibly damaging Het
Nars A T 18: 64,516,414 probably null Het
Nipsnap3a G A 4: 52,994,185 D91N probably null Het
Nphp3 A G 9: 104,002,811 T11A probably benign Het
Nr2c2 C A 6: 92,156,692 T226K probably damaging Het
Nrxn1 A G 17: 90,162,289 I1288T probably damaging Het
Nt5c1b C T 12: 10,375,537 T360I possibly damaging Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1281 G A 2: 111,328,853 V145I probably benign Het
Olfr1505 C T 19: 13,919,419 T133I probably benign Het
Olfr1508 A T 14: 52,463,831 H59Q possibly damaging Het
Olfr214 A G 6: 116,556,577 T51A probably benign Het
Olfr516 A G 7: 108,845,141 Y290H possibly damaging Het
Olfr532 A T 7: 140,418,942 L277Q probably damaging Het
Phrf1 C A 7: 141,261,874 Y715* probably null Het
Pigm T C 1: 172,376,787 V30A probably benign Het
Pkd1l2 A T 8: 117,056,419 F721I possibly damaging Het
Pla2g15 A G 8: 106,154,949 D70G possibly damaging Het
Prl7d1 A T 13: 27,709,382 I182N probably damaging Het
Prss23 T C 7: 89,510,714 K49R probably benign Het
Rps6 A T 4: 86,856,809 D19E probably benign Het
Slco6d1 A T 1: 98,507,567 H669L probably benign Het
Svil G T 18: 5,056,336 C490F probably benign Het
Tom1 T C 8: 75,051,599 I103T probably damaging Het
Trim10 T A 17: 36,876,899 Y336N probably damaging Het
Trim43c G T 9: 88,840,699 V133F probably damaging Het
Tvp23a A G 16: 10,428,687 L78P possibly damaging Het
Ugt2b38 T A 5: 87,424,132 I14L probably benign Het
Unc5a A C 13: 55,002,924 M520L probably damaging Het
Vmn1r174 T A 7: 23,753,912 M1K probably null Het
Vmn2r58 C T 7: 41,837,489 G661R possibly damaging Het
Vps41 A C 13: 18,841,243 D471A probably damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp462 T A 4: 55,013,489 F1818L possibly damaging Het
Zp3 G A 5: 135,980,281 E50K possibly damaging Het
Other mutations in Pcsk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Pcsk1 APN 13 75132087 missense probably benign
IGL01554:Pcsk1 APN 13 75132307 missense probably benign
IGL01960:Pcsk1 APN 13 75093167 missense possibly damaging 0.82
IGL02026:Pcsk1 APN 13 75112653 missense probably benign 0.16
IGL02047:Pcsk1 APN 13 75097989 missense probably benign 0.33
IGL02264:Pcsk1 APN 13 75105959 missense probably damaging 1.00
IGL02441:Pcsk1 APN 13 75132163 missense probably benign 0.16
IGL02795:Pcsk1 APN 13 75112620 missense probably damaging 1.00
IGL02829:Pcsk1 APN 13 75126836 missense probably damaging 1.00
IGL03116:Pcsk1 APN 13 75132216 missense probably damaging 0.99
IGL03156:Pcsk1 APN 13 75131951 missense probably benign
clipper UTSW 13 75130070 missense probably damaging 1.00
spareribs UTSW 13 75115255 missense possibly damaging 0.88
swivel UTSW 13 75125984 missense probably damaging 1.00
Tweeze UTSW 13 75126839 missense probably benign 0.00
PIT4453001:Pcsk1 UTSW 13 75112650 missense probably damaging 1.00
R0771:Pcsk1 UTSW 13 75132162 missense probably benign 0.31
R0894:Pcsk1 UTSW 13 75097977 missense probably damaging 1.00
R1014:Pcsk1 UTSW 13 75132234 missense probably damaging 1.00
R1035:Pcsk1 UTSW 13 75132119 missense probably benign
R1199:Pcsk1 UTSW 13 75096413 splice site probably benign
R1517:Pcsk1 UTSW 13 75098047 nonsense probably null
R1625:Pcsk1 UTSW 13 75126852 missense probably benign 0.11
R1717:Pcsk1 UTSW 13 75110828 missense probably damaging 0.99
R2168:Pcsk1 UTSW 13 75112534 intron probably benign
R2252:Pcsk1 UTSW 13 75126726 missense probably benign 0.00
R2400:Pcsk1 UTSW 13 75090126 missense probably benign 0.00
R4110:Pcsk1 UTSW 13 75096369 missense probably damaging 0.99
R4358:Pcsk1 UTSW 13 75112719 missense possibly damaging 0.58
R4359:Pcsk1 UTSW 13 75112719 missense possibly damaging 0.58
R4657:Pcsk1 UTSW 13 75132235 missense probably damaging 1.00
R5195:Pcsk1 UTSW 13 75126855 missense probably damaging 1.00
R5669:Pcsk1 UTSW 13 75130102 missense probably benign 0.01
R5671:Pcsk1 UTSW 13 75097907 missense possibly damaging 0.63
R5745:Pcsk1 UTSW 13 75131960 missense probably benign 0.03
R6107:Pcsk1 UTSW 13 75127848 missense probably benign 0.09
R6200:Pcsk1 UTSW 13 75115255 missense possibly damaging 0.88
R6326:Pcsk1 UTSW 13 75132179 missense possibly damaging 0.89
R6537:Pcsk1 UTSW 13 75132239 missense probably damaging 1.00
R6541:Pcsk1 UTSW 13 75125984 missense probably damaging 1.00
R6567:Pcsk1 UTSW 13 75130070 missense probably damaging 1.00
R6723:Pcsk1 UTSW 13 75093069 splice site probably null
R7258:Pcsk1 UTSW 13 75093186 missense probably damaging 1.00
R7357:Pcsk1 UTSW 13 75125960 missense probably damaging 0.96
R7487:Pcsk1 UTSW 13 75110883 missense probably benign 0.01
R7519:Pcsk1 UTSW 13 75110865 missense probably damaging 0.99
R7647:Pcsk1 UTSW 13 75132210 missense possibly damaging 0.73
R7787:Pcsk1 UTSW 13 75132158 missense possibly damaging 0.88
R7944:Pcsk1 UTSW 13 75132092 missense probably benign
R7945:Pcsk1 UTSW 13 75132092 missense probably benign
R7961:Pcsk1 UTSW 13 75126839 missense probably benign 0.00
R8009:Pcsk1 UTSW 13 75126839 missense probably benign 0.00
R8022:Pcsk1 UTSW 13 75099293 missense possibly damaging 0.77
R8171:Pcsk1 UTSW 13 75090091 nonsense probably null
R8489:Pcsk1 UTSW 13 75126002 missense probably damaging 1.00
R9310:Pcsk1 UTSW 13 75090072 missense probably benign
R9404:Pcsk1 UTSW 13 75132223 missense probably benign 0.11
R9544:Pcsk1 UTSW 13 75110920 missense probably damaging 0.99
R9588:Pcsk1 UTSW 13 75110920 missense probably damaging 0.99
R9706:Pcsk1 UTSW 13 75099354 critical splice donor site probably null
Z1176:Pcsk1 UTSW 13 75098042 missense probably damaging 1.00
Z1177:Pcsk1 UTSW 13 75125864 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGCTGCGACTCCTACAAAGTG -3'
(R):5'- AAAGGGCTGTGTCCCAAGAATGAC -3'

Sequencing Primer
(F):5'- GTGCTTTTAGCAAGAATGCACTTTC -3'
(R):5'- GCTGTGTCCCAAGAATGACTTTAG -3'
Posted On 2014-05-14