Incidental Mutation 'R8038:Chuk'
ID618361
Institutional Source Beutler Lab
Gene Symbol Chuk
Ensembl Gene ENSMUSG00000025199
Gene Nameconserved helix-loop-helix ubiquitous kinase
SynonymsChuk1, IKK 1, IKK alpha, IkappaB kinase alpha, IKKalpha, IKK-1, IKK-alpha, IKK[a], IKK1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8038 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location44073335-44107480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44078977 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 580 (Y580H)
Ref Sequence ENSEMBL: ENSMUSP00000026217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026217] [ENSMUST00000119591]
Predicted Effect probably damaging
Transcript: ENSMUST00000026217
AA Change: Y580H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026217
Gene: ENSMUSG00000025199
AA Change: Y580H

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 254 3.5e-39 PFAM
Pfam:Pkinase 15 298 8.3e-55 PFAM
Blast:PHB 589 659 1e-38 BLAST
IKKbetaNEMObind 706 743 1.64e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119591
AA Change: Y580H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113809
Gene: ENSMUSG00000025199
AA Change: Y580H

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:Pkinase_Tyr 15 253 9.1e-38 PFAM
Pfam:Pkinase 15 298 8.5e-54 PFAM
Blast:PHB 589 659 8e-39 BLAST
Meta Mutation Damage Score 0.0755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. The encoded protein, a component of a cytokine-activated protein complex that is an inhibitor of the essential transcription factor NF-kappa-B complex, phosphorylates sites that trigger the degradation of the inhibitor via the ubiquination pathway, thereby activating the transcription factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die neonataly and exhibit thickened, taut, adhesive skin that prevents appendages from protruding from the trunk, absence of whiskers, skeletal abnormalities, and closed esophagus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,215,904 M143K probably damaging Het
Accs A T 2: 93,842,917 probably null Het
Alkbh5 T C 11: 60,538,985 V188A probably damaging Het
Cacna1h C T 17: 25,375,891 V2098I probably damaging Het
Col7a1 A G 9: 108,957,292 N530S unknown Het
Cops2 A T 2: 125,832,286 H420Q probably benign Het
Ctcfl A T 2: 173,101,905 C551S probably damaging Het
Depdc5 T C 5: 32,959,348 probably null Het
Dnmt1 A C 9: 20,941,564 V82G probably damaging Het
Fam90a1a A T 8: 21,963,439 N270I possibly damaging Het
Foxn4 T C 5: 114,256,597 D423G probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Hoxa5 A G 6: 52,204,329 S8P probably damaging Het
Ighe A T 12: 113,269,433 V456D Het
Ighv1-52 A G 12: 115,145,590 F83S probably damaging Het
Itga2 A T 13: 114,853,755 N921K probably damaging Het
Kdm2b T C 5: 122,960,895 probably benign Het
Llgl2 T G 11: 115,851,103 M657R probably benign Het
Lrrcc1 T A 3: 14,565,830 I1019K possibly damaging Het
Lrriq3 A T 3: 155,164,001 D321V probably benign Het
Lsm10 T C 4: 126,098,097 V82A probably damaging Het
Mettl3 A G 14: 52,299,964 S154P possibly damaging Het
Naip2 T C 13: 100,162,062 I489V probably benign Het
Nat8f5 T A 6: 85,817,685 T98S possibly damaging Het
Olfr1218 A T 2: 89,054,868 L186Q probably damaging Het
Olfr1490 G A 19: 13,655,355 V309M possibly damaging Het
Olfr857 G T 9: 19,713,680 M284I possibly damaging Het
Olfr974 T A 9: 39,942,881 V207D probably damaging Het
Pld5 T C 1: 176,044,897 I225V probably benign Het
Ppfia1 C A 7: 144,514,916 A414S possibly damaging Het
Ppib T C 9: 66,060,333 V23A probably benign Het
Rabggta A T 14: 55,718,930 S361T probably benign Het
Rap1gap2 T C 11: 74,392,283 S664G probably benign Het
Recql5 A G 11: 115,927,352 V285A possibly damaging Het
Rtn4rl1 G C 11: 75,265,881 E380Q possibly damaging Het
Scarb2 A T 5: 92,451,448 S338T probably damaging Het
Skint4 T G 4: 112,119,806 probably benign Het
Slc13a5 T C 11: 72,253,370 K294R probably benign Het
Spib A G 7: 44,529,886 F32S probably benign Het
Spint2 A G 7: 29,260,129 probably benign Het
Sycp2 A T 2: 178,403,778 D16E probably damaging Het
Tab1 A G 15: 80,160,270 T500A probably benign Het
Tecpr2 T C 12: 110,936,420 F860L probably benign Het
Tg A G 15: 66,688,875 M1029V probably benign Het
Tmem126b C T 7: 90,469,622 V153I probably benign Het
Uba2 A T 7: 34,147,597 Y440N probably damaging Het
Vwa2 A G 19: 56,897,888 E129G probably benign Het
Wapl A G 14: 34,691,682 D167G probably benign Het
Zfp64 A G 2: 168,900,012 F332S probably damaging Het
Zfp786 C T 6: 47,821,254 R250H probably benign Het
Other mutations in Chuk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Chuk APN 19 44088023 missense possibly damaging 0.56
IGL00585:Chuk APN 19 44078312 missense probably damaging 0.99
IGL00662:Chuk APN 19 44097210 missense possibly damaging 0.64
IGL01419:Chuk APN 19 44096981 missense probably damaging 1.00
IGL01728:Chuk APN 19 44098646 missense possibly damaging 0.94
IGL01753:Chuk APN 19 44098576 splice site probably benign
PIT4362001:Chuk UTSW 19 44098583 critical splice donor site probably null
PIT4382001:Chuk UTSW 19 44098607 missense probably damaging 0.99
R0107:Chuk UTSW 19 44096919 missense probably damaging 1.00
R0107:Chuk UTSW 19 44096919 missense probably damaging 1.00
R0504:Chuk UTSW 19 44081938 splice site probably benign
R0731:Chuk UTSW 19 44103766 splice site probably benign
R0846:Chuk UTSW 19 44091028 missense probably damaging 1.00
R1433:Chuk UTSW 19 44078958 missense probably null 1.00
R1585:Chuk UTSW 19 44077373 missense possibly damaging 0.89
R2020:Chuk UTSW 19 44107343 missense possibly damaging 0.59
R2179:Chuk UTSW 19 44103721 missense possibly damaging 0.95
R2441:Chuk UTSW 19 44096921 missense probably damaging 1.00
R4125:Chuk UTSW 19 44100174 missense probably null 0.00
R4180:Chuk UTSW 19 44101840 missense probably benign 0.01
R4746:Chuk UTSW 19 44088771 missense possibly damaging 0.86
R4815:Chuk UTSW 19 44077247 nonsense probably null
R4852:Chuk UTSW 19 44088758 missense possibly damaging 0.91
R5330:Chuk UTSW 19 44078955 missense probably damaging 1.00
R5331:Chuk UTSW 19 44078955 missense probably damaging 1.00
R5517:Chuk UTSW 19 44097533 critical splice acceptor site probably null
R5854:Chuk UTSW 19 44081957 missense probably benign 0.00
R6149:Chuk UTSW 19 44101831 missense probably damaging 1.00
R6161:Chuk UTSW 19 44082637 missense probably damaging 1.00
R6232:Chuk UTSW 19 44096992 missense probably benign 0.21
R6768:Chuk UTSW 19 44096951 missense probably damaging 0.96
R6865:Chuk UTSW 19 44086915 nonsense probably null
R7916:Chuk UTSW 19 44096981 missense probably damaging 1.00
R8064:Chuk UTSW 19 44082676 missense probably damaging 1.00
R8187:Chuk UTSW 19 44091112 missense probably benign 0.05
R8272:Chuk UTSW 19 44103736 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GCATATGTTCAGGGCTTACAC -3'
(R):5'- AGCTAAGACAACAGCAGTGC -3'

Sequencing Primer
(F):5'- ACACAGCACCATGTTTTATAAGATAC -3'
(R):5'- GTGCCACACTTCAAGGACAGTG -3'
Posted On2020-01-23