Mutagenetix > Incidental Mutations

Incidental Mutation 'R6161:Chuk'

489900

Institutional Source

Beutler Lab

Gene Symbol

Chuk

Ensembl Gene

ENSMUSG00000025199

Gene Name

conserved helix-loop-helix ubiquitous kinase

Synonyms

Chuk1, IKK 1, IKK alpha, IkappaB kinase alpha, IKKalpha, IKK-1, IKK-alpha, IKK[a], IKK1

MMRRC Submission

044308-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6161 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

44073335-44107480 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 44082637 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 543 (E543G)

Ref Sequence

ENSEMBL: ENSMUSP00000026217 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026217] [ENSMUST00000119591]

Predicted Effect

probably damaging
Transcript: ENSMUST00000026217
AA Change: E543G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000026217
Gene: ENSMUSG00000025199
AA Change: E543G

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
Pfam:Pkinase_Tyr	15	254	3.5e-39	PFAM
Pfam:Pkinase	15	298	8.3e-55	PFAM
Blast:PHB	589	659	1e-38	BLAST
IKKbetaNEMObind	706	743	1.64e-15	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000119591
AA Change: E543G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113809
Gene: ENSMUSG00000025199
AA Change: E543G

Domain	Start	End	E-Value	Type
low complexity region	3	14	N/A	INTRINSIC
Pfam:Pkinase_Tyr	15	253	9.1e-38	PFAM
Pfam:Pkinase	15	298	8.5e-54	PFAM
Blast:PHB	589	659	8e-39	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123806

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134495

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144286

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147423

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.9%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. The encoded protein, a component of a cytokine-activated protein complex that is an inhibitor of the essential transcription factor NF-kappa-B complex, phosphorylates sites that trigger the degradation of the inhibitor via the ubiquination pathway, thereby activating the transcription factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die neonataly and exhibit thickened, taut, adhesive skin that prevents appendages from protruding from the trunk, absence of whiskers, skeletal abnormalities, and closed esophagus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca16	A	T	7: 120,540,711	K1533M	probably damaging	Het
Aldh1l2	C	T	10: 83,520,338	V63I	probably benign	Het
Atr	A	G	9: 95,865,319	H218R	probably benign	Het
Atxn7l1	T	A	12: 33,358,663	S275T	possibly damaging	Het
Cacna1c	T	C	6: 119,057,302	K88R	probably damaging	Het
Ccl7	T	C	11: 82,046,586	Y49H	probably damaging	Het
Cd3eap	G	A	7: 19,357,633	T183I	possibly damaging	Het
Cers5	A	G	15: 99,738,663		probably null	Het
Dip2c	T	C	13: 9,647,007	V1318A	probably damaging	Het
Ercc5	A	G	1: 44,167,352	H475R	probably benign	Het
Fat3	A	G	9: 16,377,522	L235P	probably damaging	Het
Fbn1	A	T	2: 125,369,801	C892*	probably null	Het
Fbxw8	T	C	5: 118,092,675	T354A	possibly damaging	Het
Fsip2	A	C	2: 82,987,257	T4445P	possibly damaging	Het
Gpld1	A	T	13: 24,971,414	Q344L	probably benign	Het
Hao1	A	T	2: 134,505,625	D253E	probably benign	Het
Hmcn2	A	G	2: 31,356,254	D745G	probably benign	Het
Kcnt1	A	G	2: 25,903,385	T658A	probably benign	Het
Klhl35	A	G	7: 99,473,337		probably benign	Het
Lnx2	C	T	5: 147,042,026		probably null	Het
Map3k5	T	C	10: 20,000,575	V160A	probably damaging	Het
Masp2	A	T	4: 148,614,012	I517F	possibly damaging	Het
Mc4r	A	T	18: 66,859,180	Y287*	probably null	Het
Mthfr	A	G	4: 148,041,754	D94G	probably benign	Het
Muc16	A	G	9: 18,647,818	I2393T	unknown	Het
Mybbp1a	G	T	11: 72,446,012	V557L	probably damaging	Het
Mycbp2	A	T	14: 103,298,747	W256R	probably damaging	Het
Nacad	G	A	11: 6,600,902	S763L	probably benign	Het
Nebl	A	G	2: 17,730,830	V11A	probably benign	Het
Notch1	A	T	2: 26,468,731	C1363S	probably damaging	Het
Nphp3	A	G	9: 104,031,906	N772D	probably benign	Het
Nqo2	G	A	13: 33,979,651	V98M	probably damaging	Het
Pak4	A	G	7: 28,565,267	I70T	possibly damaging	Het
Pbx2	A	G	17: 34,593,600	K2E	probably damaging	Het
Pikfyve	A	G	1: 65,216,043	T352A	probably benign	Het
Pop1	T	C	15: 34,526,310	Y684H	probably damaging	Het
Rpa1	A	G	11: 75,314,895	V212A	probably damaging	Het
Rpap2	A	G	5: 107,620,670	E458G	probably damaging	Het
Sin3a	T	C	9: 57,095,424	V200A	possibly damaging	Het
Sla	T	C	15: 66,782,598	T280A	probably null	Het
Slc22a26	A	T	19: 7,786,447	I406K	possibly damaging	Het
Slc24a1	T	C	9: 64,937,263	N606S	unknown	Het
Slc39a10	G	A	1: 46,827,407	T443M	probably damaging	Het
Smg1	A	T	7: 118,163,330		probably benign	Het
Sra1	G	A	18: 36,670,283	A9V	probably damaging	Het
Stard4	A	G	18: 33,209,056	V47A	probably damaging	Het
Stat4	A	T	1: 52,074,677	D182V	possibly damaging	Het
Syt1	A	G	10: 108,631,807	F210L	probably damaging	Het
Ube2q1	T	A	3: 89,781,360		probably null	Het
Vmn1r159	C	T	7: 22,843,187	C140Y	possibly damaging	Het
Wnt8a	T	C	18: 34,545,546	F138L	possibly damaging	Het
Zfp623	T	A	15: 75,948,621	D475E	probably benign	Het
Zfp646	C	T	7: 127,878,725	R25W	probably damaging	Het

Other mutations in Chuk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Chuk	APN	19	44088023	missense	possibly damaging	0.56
IGL00585:Chuk	APN	19	44078312	missense	probably damaging	0.99
IGL00662:Chuk	APN	19	44097210	missense	possibly damaging	0.64
IGL01419:Chuk	APN	19	44096981	missense	probably damaging	1.00
IGL01728:Chuk	APN	19	44098646	missense	possibly damaging	0.94
IGL01753:Chuk	APN	19	44098576	splice site	probably benign
PIT4362001:Chuk	UTSW	19	44098583	critical splice donor site	probably null
PIT4382001:Chuk	UTSW	19	44098607	missense	probably damaging	0.99
R0107:Chuk	UTSW	19	44096919	missense	probably damaging	1.00
R0107:Chuk	UTSW	19	44096919	missense	probably damaging	1.00
R0504:Chuk	UTSW	19	44081938	splice site	probably benign
R0731:Chuk	UTSW	19	44103766	splice site	probably benign
R0846:Chuk	UTSW	19	44091028	missense	probably damaging	1.00
R1433:Chuk	UTSW	19	44078958	missense	probably null	1.00
R1585:Chuk	UTSW	19	44077373	missense	possibly damaging	0.89
R2020:Chuk	UTSW	19	44107343	missense	possibly damaging	0.59
R2179:Chuk	UTSW	19	44103721	missense	possibly damaging	0.95
R2441:Chuk	UTSW	19	44096921	missense	probably damaging	1.00
R4125:Chuk	UTSW	19	44100174	missense	probably null	0.00
R4180:Chuk	UTSW	19	44101840	missense	probably benign	0.01
R4746:Chuk	UTSW	19	44088771	missense	possibly damaging	0.86
R4815:Chuk	UTSW	19	44077247	nonsense	probably null
R4852:Chuk	UTSW	19	44088758	missense	possibly damaging	0.91
R5330:Chuk	UTSW	19	44078955	missense	probably damaging	1.00
R5331:Chuk	UTSW	19	44078955	missense	probably damaging	1.00
R5517:Chuk	UTSW	19	44097533	critical splice acceptor site	probably null
R5854:Chuk	UTSW	19	44081957	missense	probably benign	0.00
R6149:Chuk	UTSW	19	44101831	missense	probably damaging	1.00
R6232:Chuk	UTSW	19	44096992	missense	probably benign	0.21
R6768:Chuk	UTSW	19	44096951	missense	probably damaging	0.96
R6865:Chuk	UTSW	19	44086915	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCCCTATGACTAAGAAAGAGCTTC -3'
(R):5'- TAGCTTTAACCAGTCTAGTGTGC -3'

Sequencing Primer
(F):5'- AACCTGAGTTCAATTCCTGGG -3'
(R):5'- TACAGGTTCAAGACTAGTCTAGCC -3'

Posted On

2017-10-10