Mutagenetix > Incidental Mutation

Incidental Mutation 'R8062:Rsf1'

619782

Institutional Source

Beutler Lab

Gene Symbol

Rsf1

Ensembl Gene

ENSMUSG00000035623

Gene Name

remodeling and spacing factor 1

Synonyms

p325, Hbxap, C030033M12Rik, 4832420A03Rik, XAP8

MMRRC Submission

067498-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8062 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

97579889-97692778 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 97677387 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1039 (D1039E)

Ref Sequence

ENSEMBL: ENSMUSP00000102771 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107153] [ENSMUST00000123731] [ENSMUST00000135270]

AlphaFold

E9PWW9

Predicted Effect

SMART Domains

Protein: ENSMUSP00000102771
Gene: ENSMUSG00000035623
AA Change: D1039E

Domain	Start	End	E-Value	Type
low complexity region	25	38	N/A	INTRINSIC
Pfam:WHIM1	88	138	2.2e-10	PFAM
Pfam:WHIM2	140	172	9.4e-8	PFAM
Pfam:WHIM3	178	398	2.5e-27	PFAM
low complexity region	743	758	N/A	INTRINSIC
low complexity region	845	859	N/A	INTRINSIC
low complexity region	863	872	N/A	INTRINSIC
PHD	881	927	1.57e-11	SMART
low complexity region	945	959	N/A	INTRINSIC
low complexity region	971	993	N/A	INTRINSIC
low complexity region	1011	1030	N/A	INTRINSIC
low complexity region	1072	1096	N/A	INTRINSIC
low complexity region	1110	1128	N/A	INTRINSIC
low complexity region	1133	1152	N/A	INTRINSIC
low complexity region	1160	1190	N/A	INTRINSIC
low complexity region	1192	1198	N/A	INTRINSIC
low complexity region	1234	1248	N/A	INTRINSIC
low complexity region	1268	1280	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123731

Predicted Effect

probably benign
Transcript: ENSMUST00000135270

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with hepatitis B virus X protein (HBX) and facilitates transcription of hepatitis B virus genes by the HBX transcription activator, suggesting a role for this interaction in the virus life cycle. This protein also interacts with SNF2H protein to form the RSF chromatin-remodeling complex, where the SNF2H subunit functions as the nucleosome-dependent ATPase, and this protein as the histone chaperone. [provided by RefSeq, Sep 2011]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abce1	A	T	8: 79,701,144	Y172N	possibly damaging	Het
Abhd2	T	A	7: 79,325,590	M176K	possibly damaging	Het
Adamts14	A	G	10: 61,200,361		probably null	Het
Atg2a	T	C	19: 6,252,579		probably null	Het
AW822073	G	A	10: 58,223,810	A374V	unknown	Het
Bach2	G	A	4: 32,562,937	G468E	probably damaging	Het
Bap1	T	A	14: 31,257,508	N489K	probably benign	Het
Btaf1	G	A	19: 36,992,465	V1180I	probably benign	Het
Calm5	A	G	13: 3,854,405	H33R	probably benign	Het
Cnr1	T	A	4: 33,944,707	V365E	possibly damaging	Het
Crym	A	C	7: 120,201,168	V77G	probably damaging	Het
Cyp2j7	T	A	4: 96,215,350	E316V	probably null	Het
Dab2	G	A	15: 6,427,341	G233D	probably damaging	Het
Ddx19b	A	T	8: 111,020,979	S108T	probably benign	Het
Dsc2	C	T	18: 20,032,274	G881R	possibly damaging	Het
Duxf3	A	C	10: 58,230,928	M93R	probably benign	Het
Duxf3	G	A	10: 58,231,067	L537F	probably damaging	Het
Eif2s2	A	G	2: 154,877,804	F182L	possibly damaging	Het
Erlin1	T	A	19: 44,056,159	K156I	probably benign	Het
Gapvd1	A	G	2: 34,678,114	S1413P	probably benign	Het
Gm1110	G	A	9: 26,881,821	A553V	probably damaging	Het
Gm3250	C	A	10: 77,782,400	C48F	unknown	Het
Gm3604	T	C	13: 62,370,341	S68G	probably damaging	Het
Golga5	T	A	12: 102,484,480	M464K	probably benign	Het
Gpr142	G	A	11: 114,806,531	R301Q	probably benign	Het
Gria4	C	T	9: 4,480,273	D392N	possibly damaging	Het
Grik2	T	A	10: 49,240,767	T633S	probably damaging	Het
Gsap	T	A	5: 21,194,463	I54N	probably damaging	Het
Hdlbp	A	G	1: 93,438,342	Y40H	probably benign	Het
Hyal5	C	A	6: 24,876,197	T23K	possibly damaging	Het
Itga6	T	A	2: 71,841,743	F834L	probably benign	Het
K230010J24Rik	G	A	15: 76,046,754	R508H	probably benign	Het
Klf1	T	A	8: 84,903,299	L251Q	probably benign	Het
Kndc1	A	G	7: 139,918,844	D558G	probably benign	Het
Ktn1	T	A	14: 47,724,972		probably null	Het
Lcmt2	A	G	2: 121,140,272	V110A	possibly damaging	Het
Lgr4	C	T	2: 110,000,937	R304C	probably damaging	Het
Lnpk	T	A	2: 74,551,063	I119L	possibly damaging	Het
Med13	A	G	11: 86,319,438	V626A	probably benign	Het
Mroh9	A	T	1: 163,038,975	L700M	probably damaging	Het
Muc4	T	A	16: 32,756,749	W138R		Het
Myh2	G	T	11: 67,193,383	E1611*	probably null	Het
Myo9b	T	G	8: 71,321,813	S323A	probably damaging	Het
Olfr1086	A	C	2: 86,677,066	V89G	probably benign	Het
Olfr1263	T	A	2: 90,015,736	F269I	possibly damaging	Het
Olfr135	A	T	17: 38,209,174	I310F	probably benign	Het
Olfr888	G	T	9: 38,108,917	C72F	probably damaging	Het
P2ry13	A	T	3: 59,210,282	M25K	probably benign	Het
Pan3	T	A	5: 147,527,150	F571Y	probably benign	Het
Pdcd11	A	G	19: 47,130,713	D1831G	possibly damaging	Het
Peg10	CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG	CCACATCAGGATCCACATCAGGATGCACATCAG	6: 4,756,398		probably benign	Het
Pex1	T	G	5: 3,605,656	M161R	probably benign	Het
Piezo2	T	A	18: 63,030,466	D2127V	possibly damaging	Het
Plod3	A	T	5: 136,990,269	H336L	possibly damaging	Het
Pp2d1	A	T	17: 53,515,770	N89K	probably benign	Het
Ppp4r3a	A	G	12: 101,041,971	S736P	probably damaging	Het
Prp2	C	A	6: 132,600,688	Q313K	unknown	Het
Psma5	T	G	3: 108,266,479	D90E	probably benign	Het
Reln	G	A	5: 21,971,992	T1892I	probably benign	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rtel1	A	G	2: 181,340,567	D370G	probably benign	Het
Scyl2	T	A	10: 89,654,160	N447Y	probably damaging	Het
Sis	A	T	3: 72,920,988	Y1222*	probably null	Het
Slc37a3	A	T	6: 39,364,596	H35Q	probably damaging	Het
Sltm	A	T	9: 70,573,497	K210N	unknown	Het
Spata3	T	C	1: 86,024,426	I134T	unknown	Het
Speer4d	A	T	5: 15,620,439	N54I	possibly damaging	Het
Spert	A	T	14: 75,592,606	I49N	probably benign	Het
Syne1	A	G	10: 5,185,394		probably null	Het
Tars	A	T	15: 11,388,314	F465Y	possibly damaging	Het
Tlr4	T	G	4: 66,839,850	N293K	probably benign	Het
Tmprss13	C	A	9: 45,328,688	T98K	unknown	Het
Tnfsf8	G	A	4: 63,861,195		probably benign	Het
Trim30b	T	A	7: 104,366,186		probably benign	Het
Trpm1	A	G	7: 64,201,941	K136E	probably benign	Het
Ttc6	A	G	12: 57,736,978	Y1741C	possibly damaging	Het
Usp38	T	C	8: 80,984,589	D939G	probably damaging	Het
Vmn1r196	T	A	13: 22,293,270	N26K	probably damaging	Het
Vmn2r50	C	A	7: 10,040,313		probably null	Het
Wdr3	T	A	3: 100,142,494	M773L	probably benign	Het
Zfp993	T	G	4: 146,654,958		probably null	Het

Other mutations in Rsf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00650:Rsf1	APN	7	97681889	critical splice donor site	probably null	0.00
IGL01160:Rsf1	APN	7	97685584	missense	probably damaging	1.00
IGL01780:Rsf1	APN	7	97664770	critical splice donor site	probably benign	0.00
IGL01960:Rsf1	APN	7	97661575	missense	probably benign	0.00
IGL02487:Rsf1	APN	7	97639491	missense	probably damaging	0.99
IGL02814:Rsf1	APN	7	97661227	missense	probably damaging	1.00
IGL02972:Rsf1	APN	7	97661326	missense	probably benign	0.35
IGL03176:Rsf1	APN	7	97679150	splice site	probably benign
IGL03256:Rsf1	APN	7	97679004	missense	possibly damaging	0.82
BB011:Rsf1	UTSW	7	97579909	unclassified	probably benign
BB014:Rsf1	UTSW	7	97579924	unclassified	probably benign
BB018:Rsf1	UTSW	7	97579909	unclassified	probably benign
FR4976:Rsf1	UTSW	7	97579909	unclassified	probably benign
G1Funyon:Rsf1	UTSW	7	97661925	missense
P0023:Rsf1	UTSW	7	97662271	missense	probably damaging	1.00
R0144:Rsf1	UTSW	7	97636407	missense	probably damaging	1.00
R0380:Rsf1	UTSW	7	97579905	unclassified	probably benign
R0392:Rsf1	UTSW	7	97679005	missense	probably benign	0.00
R0422:Rsf1	UTSW	7	97680817	missense	probably benign	0.04
R0584:Rsf1	UTSW	7	97662128	missense	possibly damaging	0.60
R0636:Rsf1	UTSW	7	97662019	missense	possibly damaging	0.74
R0729:Rsf1	UTSW	7	97679027	missense	probably damaging	1.00
R0755:Rsf1	UTSW	7	97579967	missense	probably damaging	1.00
R0947:Rsf1	UTSW	7	97669778	missense	probably damaging	1.00
R1278:Rsf1	UTSW	7	97579904	unclassified	probably benign
R1376:Rsf1	UTSW	7	97579907	unclassified	probably benign
R1376:Rsf1	UTSW	7	97579907	unclassified	probably benign
R1498:Rsf1	UTSW	7	97579907	unclassified	probably benign
R1525:Rsf1	UTSW	7	97579908	unclassified	probably benign
R1534:Rsf1	UTSW	7	97579909	unclassified	probably benign
R1582:Rsf1	UTSW	7	97579908	unclassified	probably benign
R1591:Rsf1	UTSW	7	97639313	nonsense	probably null
R1676:Rsf1	UTSW	7	97579904	unclassified	probably benign
R1695:Rsf1	UTSW	7	97579907	unclassified	probably benign
R1710:Rsf1	UTSW	7	97662349	missense	possibly damaging	0.50
R1722:Rsf1	UTSW	7	97579908	unclassified	probably benign
R1764:Rsf1	UTSW	7	97579908	unclassified	probably benign
R1815:Rsf1	UTSW	7	97579906	unclassified	probably benign
R1815:Rsf1	UTSW	7	97579907	unclassified	probably benign
R1815:Rsf1	UTSW	7	97579908	unclassified	probably benign
R1823:Rsf1	UTSW	7	97579910	unclassified	probably benign
R1864:Rsf1	UTSW	7	97579904	unclassified	probably benign
R1884:Rsf1	UTSW	7	97579910	unclassified	probably benign
R1897:Rsf1	UTSW	7	97579910	unclassified	probably benign
R1915:Rsf1	UTSW	7	97579907	unclassified	probably benign
R1928:Rsf1	UTSW	7	97579909	unclassified	probably benign
R1958:Rsf1	UTSW	7	97579908	unclassified	probably benign
R1962:Rsf1	UTSW	7	97579906	unclassified	probably benign
R1962:Rsf1	UTSW	7	97579907	unclassified	probably benign
R1996:Rsf1	UTSW	7	97664632	missense	probably damaging	1.00
R1999:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2021:Rsf1	UTSW	7	97579906	unclassified	probably benign
R2022:Rsf1	UTSW	7	97579910	unclassified	probably benign
R2046:Rsf1	UTSW	7	97661677	missense	probably benign	0.00
R2048:Rsf1	UTSW	7	97579907	unclassified	probably benign
R2093:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2103:Rsf1	UTSW	7	97579906	unclassified	probably benign
R2137:Rsf1	UTSW	7	97579904	unclassified	probably benign
R2167:Rsf1	UTSW	7	97579906	unclassified	probably benign
R2179:Rsf1	UTSW	7	97579909	unclassified	probably benign
R2191:Rsf1	UTSW	7	97579907	unclassified	probably benign
R2207:Rsf1	UTSW	7	97579907	unclassified	probably benign
R2211:Rsf1	UTSW	7	97579904	unclassified	probably benign
R2241:Rsf1	UTSW	7	97579904	unclassified	probably benign
R2264:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2283:Rsf1	UTSW	7	97579909	unclassified	probably benign
R2297:Rsf1	UTSW	7	97579904	unclassified	probably benign
R2307:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2419:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2442:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2696:Rsf1	UTSW	7	97579933	unclassified	probably benign
R2764:Rsf1	UTSW	7	97579904	unclassified	probably benign
R2939:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2965:Rsf1	UTSW	7	97579908	unclassified	probably benign
R2972:Rsf1	UTSW	7	97579904	unclassified	probably benign
R3008:Rsf1	UTSW	7	97579904	unclassified	probably benign
R3013:Rsf1	UTSW	7	97579904	unclassified	probably benign
R3026:Rsf1	UTSW	7	97579909	unclassified	probably benign
R3110:Rsf1	UTSW	7	97579904	unclassified	probably benign
R3147:Rsf1	UTSW	7	97579908	unclassified	probably benign
R3427:Rsf1	UTSW	7	97579907	unclassified	probably benign
R3610:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R3624:Rsf1	UTSW	7	97579904	unclassified	probably benign
R3753:Rsf1	UTSW	7	97662152	missense	probably benign	0.00
R3759:Rsf1	UTSW	7	97579909	unclassified	probably benign
R3780:Rsf1	UTSW	7	97579904	unclassified	probably benign
R3794:Rsf1	UTSW	7	97579904	unclassified	probably benign
R3889:Rsf1	UTSW	7	97579906	unclassified	probably benign
R3925:Rsf1	UTSW	7	97579907	unclassified	probably benign
R3964:Rsf1	UTSW	7	97579907	unclassified	probably benign
R4037:Rsf1	UTSW	7	97579904	unclassified	probably benign
R4057:Rsf1	UTSW	7	97579906	unclassified	probably benign
R4057:Rsf1	UTSW	7	97579907	unclassified	probably benign
R4084:Rsf1	UTSW	7	97579919	unclassified	probably benign
R4240:Rsf1	UTSW	7	97579935	unclassified	probably benign
R4303:Rsf1	UTSW	7	97579920	unclassified	probably benign
R4383:Rsf1	UTSW	7	97685476	missense	possibly damaging	0.86
R4492:Rsf1	UTSW	7	97579923	unclassified	probably benign
R4525:Rsf1	UTSW	7	97579926	unclassified	probably benign
R4530:Rsf1	UTSW	7	97579923	unclassified	probably benign
R4543:Rsf1	UTSW	7	97579922	unclassified	probably benign
R4629:Rsf1	UTSW	7	97579906	unclassified	probably benign
R4629:Rsf1	UTSW	7	97579908	unclassified	probably benign
R4632:Rsf1	UTSW	7	97579904	unclassified	probably benign
R4633:Rsf1	UTSW	7	97579907	unclassified	probably benign
R4652:Rsf1	UTSW	7	97579919	unclassified	probably benign
R4675:Rsf1	UTSW	7	97579910	unclassified	probably benign
R4675:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R4677:Rsf1	UTSW	7	97680773	missense	possibly damaging	0.82
R4678:Rsf1	UTSW	7	97579906	unclassified	probably benign
R4769:Rsf1	UTSW	7	97676222	missense	probably damaging	1.00
R4774:Rsf1	UTSW	7	97579916	unclassified	probably benign
R4820:Rsf1	UTSW	7	97579919	unclassified	probably benign
R4917:Rsf1	UTSW	7	97662405	missense	probably damaging	1.00
R4918:Rsf1	UTSW	7	97662405	missense	probably damaging	1.00
R4977:Rsf1	UTSW	7	97579916	unclassified	probably benign
R4979:Rsf1	UTSW	7	97579907	unclassified	probably benign
R4994:Rsf1	UTSW	7	97579909	unclassified	probably benign
R4994:Rsf1	UTSW	7	97579923	unclassified	probably benign
R5041:Rsf1	UTSW	7	97579925	unclassified	probably benign
R5125:Rsf1	UTSW	7	97661872	missense	possibly damaging	0.87
R5178:Rsf1	UTSW	7	97661872	missense	possibly damaging	0.87
R5306:Rsf1	UTSW	7	97579929	unclassified	probably benign
R5369:Rsf1	UTSW	7	97579904	unclassified	probably benign
R5371:Rsf1	UTSW	7	97579913	unclassified	probably benign
R5403:Rsf1	UTSW	7	97579907	unclassified	probably benign
R5436:Rsf1	UTSW	7	97579931	unclassified	probably benign
R5450:Rsf1	UTSW	7	97579908	unclassified	probably benign
R5532:Rsf1	UTSW	7	97680695	missense	probably damaging	1.00
R5587:Rsf1	UTSW	7	97662121	missense	probably benign	0.02
R5657:Rsf1	UTSW	7	97579934	unclassified	probably benign
R5689:Rsf1	UTSW	7	97579934	unclassified	probably benign
R5745:Rsf1	UTSW	7	97579920	unclassified	probably benign
R5748:Rsf1	UTSW	7	97579928	unclassified	probably benign
R5773:Rsf1	UTSW	7	97579933	unclassified	probably benign
R5859:Rsf1	UTSW	7	97685559	missense	probably damaging	1.00
R5938:Rsf1	UTSW	7	97685559	missense	probably damaging	1.00
R6001:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R6001:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6001:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6021:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6025:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6030:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6030:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6035:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6035:Rsf1	UTSW	7	97662109	missense	probably benign	0.01
R6035:Rsf1	UTSW	7	97662109	missense	probably benign	0.01
R6035:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6036:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6037:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6037:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6073:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6077:Rsf1	UTSW	7	97579928	unclassified	probably benign
R6102:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6111:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6126:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6128:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6130:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6154:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R6154:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6165:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6166:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6182:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6189:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6200:Rsf1	UTSW	7	97579925	unclassified	probably benign
R6210:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6212:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6214:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6215:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6216:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6232:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6235:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6242:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6243:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6244:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6268:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6269:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6273:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6275:Rsf1	UTSW	7	97579923	unclassified	probably benign
R6286:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6291:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6293:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6297:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6302:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6309:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6312:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R6324:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6343:Rsf1	UTSW	7	97660917	missense	probably benign	0.30
R6346:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R6356:Rsf1	UTSW	7	97661934	missense	probably benign
R6370:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6377:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6377:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6378:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6394:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6398:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6406:Rsf1	UTSW	7	97579926	unclassified	probably benign
R6413:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6443:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6453:Rsf1	UTSW	7	97579917	unclassified	probably benign
R6471:Rsf1	UTSW	7	97579914	unclassified	probably benign
R6473:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6497:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6505:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6561:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6572:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6607:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6611:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6622:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6626:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6636:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6647:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6648:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6669:Rsf1	UTSW	7	97579925	unclassified	probably benign
R6673:Rsf1	UTSW	7	97579918	unclassified	probably benign
R6679:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R6685:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6694:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6694:Rsf1	UTSW	7	97579928	unclassified	probably benign
R6695:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6697:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6726:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6739:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6747:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6751:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6771:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6773:Rsf1	UTSW	7	97579907	unclassified	probably benign
R6787:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6800:Rsf1	UTSW	7	97579932	unclassified	probably benign
R6804:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6806:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6815:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6820:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6823:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6829:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6861:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6862:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6869:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6875:Rsf1	UTSW	7	97579908	unclassified	probably benign
R6889:Rsf1	UTSW	7	97579925	unclassified	probably benign
R6897:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6960:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6963:Rsf1	UTSW	7	97579910	unclassified	probably benign
R6967:Rsf1	UTSW	7	97579909	unclassified	probably benign
R6969:Rsf1	UTSW	7	97579904	unclassified	probably benign
R6977:Rsf1	UTSW	7	97579906	unclassified	probably benign
R6996:Rsf1	UTSW	7	97579911	unclassified	probably benign
R7066:Rsf1	UTSW	7	97579918	unclassified	probably benign
R7109:Rsf1	UTSW	7	97579908	unclassified	probably benign
R7127:Rsf1	UTSW	7	97579914	unclassified	probably benign
R7138:Rsf1	UTSW	7	97669795	missense
R7214:Rsf1	UTSW	7	97579929	unclassified	probably benign
R7217:Rsf1	UTSW	7	97579932	unclassified	probably benign
R7238:Rsf1	UTSW	7	97579921	unclassified	probably benign
R7246:Rsf1	UTSW	7	97579922	unclassified	probably benign
R7253:Rsf1	UTSW	7	97579915	unclassified	probably benign
R7294:Rsf1	UTSW	7	97579920	unclassified	probably benign
R7305:Rsf1	UTSW	7	97579918	unclassified	probably benign
R7309:Rsf1	UTSW	7	97579911	unclassified	probably benign
R7352:Rsf1	UTSW	7	97579926	unclassified	probably benign
R7380:Rsf1	UTSW	7	97579915	unclassified	probably benign
R7393:Rsf1	UTSW	7	97579917	unclassified	probably benign
R7395:Rsf1	UTSW	7	97579926	unclassified	probably benign
R7411:Rsf1	UTSW	7	97579932	unclassified	probably benign
R7413:Rsf1	UTSW	7	97579921	unclassified	probably benign
R7481:Rsf1	UTSW	7	97579917	unclassified	probably benign
R7538:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7541:Rsf1	UTSW	7	97579911	unclassified	probably benign
R7545:Rsf1	UTSW	7	97579927	unclassified	probably benign
R7574:Rsf1	UTSW	7	97661167	missense
R7578:Rsf1	UTSW	7	97579932	unclassified	probably benign
R7599:Rsf1	UTSW	7	97579904	unclassified	probably benign
R7630:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7632:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7710:Rsf1	UTSW	7	97681834	missense
R7711:Rsf1	UTSW	7	97579909	unclassified	probably benign
R7715:Rsf1	UTSW	7	97579912	unclassified	probably benign
R7719:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7722:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7729:Rsf1	UTSW	7	97579911	unclassified	probably benign
R7734:Rsf1	UTSW	7	97579908	unclassified	probably benign
R7743:Rsf1	UTSW	7	97579932	unclassified	probably benign
R7761:Rsf1	UTSW	7	97579920	unclassified	probably benign
R7764:Rsf1	UTSW	7	97579927	unclassified	probably benign
R7797:Rsf1	UTSW	7	97661485	missense
R7802:Rsf1	UTSW	7	97661772	missense
R7806:Rsf1	UTSW	7	97579920	unclassified	probably benign
R7821:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7823:Rsf1	UTSW	7	97579907	unclassified	probably benign
R7824:Rsf1	UTSW	7	97579908	unclassified	probably benign
R7825:Rsf1	UTSW	7	97579909	unclassified	probably benign
R7826:Rsf1	UTSW	7	97661161	unclassified	probably benign
R7841:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R7854:Rsf1	UTSW	7	97579924	unclassified	probably benign
R7862:Rsf1	UTSW	7	97579923	unclassified	probably benign
R7893:Rsf1	UTSW	7	97661958	missense
R7923:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7924:Rsf1	UTSW	7	97579909	unclassified	probably benign
R7927:Rsf1	UTSW	7	97579924	unclassified	probably benign
R7931:Rsf1	UTSW	7	97579909	unclassified	probably benign
R7951:Rsf1	UTSW	7	97579912	unclassified	probably benign
R7957:Rsf1	UTSW	7	97579906	unclassified	probably benign
R7960:Rsf1	UTSW	7	97579917	unclassified	probably benign
R7979:Rsf1	UTSW	7	97685713	missense
R7982:Rsf1	UTSW	7	97579932	unclassified	probably benign
R7991:Rsf1	UTSW	7	97661333	missense
R8028:Rsf1	UTSW	7	97579908	unclassified	probably benign
R8030:Rsf1	UTSW	7	97579909	unclassified	probably benign
R8042:Rsf1	UTSW	7	97579909	unclassified	probably benign
R8076:Rsf1	UTSW	7	97579904	unclassified	probably benign
R8117:Rsf1	UTSW	7	97639257	splice site	probably null
R8132:Rsf1	UTSW	7	97579908	unclassified	probably benign
R8153:Rsf1	UTSW	7	97579906	unclassified	probably benign
R8155:Rsf1	UTSW	7	97579907	unclassified	probably benign
R8166:Rsf1	UTSW	7	97579909	unclassified	probably benign
R8197:Rsf1	UTSW	7	97579914	unclassified	probably benign
R8235:Rsf1	UTSW	7	97676254	utr 3 prime	probably benign
R8245:Rsf1	UTSW	7	97579915	unclassified	probably benign
R8282:Rsf1	UTSW	7	97579920	frame shift	probably null
R8301:Rsf1	UTSW	7	97661925	missense
R8315:Rsf1	UTSW	7	97579923	unclassified	probably benign
R8343:Rsf1	UTSW	7	97579904	unclassified	probably benign
R8370:Rsf1	UTSW	7	97579929	unclassified	probably benign
R8372:Rsf1	UTSW	7	97662417	missense
R8376:Rsf1	UTSW	7	97579917	unclassified	probably benign
R8382:Rsf1	UTSW	7	97579917	unclassified	probably benign
R8392:Rsf1	UTSW	7	97579909	unclassified	probably benign
R8410:Rsf1	UTSW	7	97579917	unclassified	probably benign
R8443:Rsf1	UTSW	7	97616896	missense
R8502:Rsf1	UTSW	7	97579914	unclassified	probably benign
R8529:Rsf1	UTSW	7	97670867	utr 3 prime	probably benign
R8537:Rsf1	UTSW	7	97579914	unclassified	probably benign
R8554:Rsf1	UTSW	7	97579923	unclassified	probably benign
R8558:Rsf1	UTSW	7	97579907	unclassified	probably benign
R8735:Rsf1	UTSW	7	97579907	unclassified	probably benign
R8742:Rsf1	UTSW	7	97579914	unclassified	probably benign
R8772:Rsf1	UTSW	7	97579908	unclassified	probably benign
R8862:Rsf1	UTSW	7	97579907	unclassified	probably benign
R8866:Rsf1	UTSW	7	97579913	unclassified	probably benign
R8889:Rsf1	UTSW	7	97579909	unclassified	probably benign
R8889:Rsf1	UTSW	7	97678964	missense
R8891:Rsf1	UTSW	7	97579909	unclassified	probably benign
R8892:Rsf1	UTSW	7	97678964	missense
R8907:Rsf1	UTSW	7	97579906	unclassified	probably benign
R8907:Rsf1	UTSW	7	97579918	unclassified	probably benign
R8913:Rsf1	UTSW	7	97579906	unclassified	probably benign
R8916:Rsf1	UTSW	7	97579933	unclassified	probably benign
R8924:Rsf1	UTSW	7	97579907	unclassified	probably benign
R8940:Rsf1	UTSW	7	97579906	unclassified	probably benign
R8946:Rsf1	UTSW	7	97579906	unclassified	probably benign
R8947:Rsf1	UTSW	7	97681852	unclassified	probably benign
R8951:Rsf1	UTSW	7	97579904	unclassified	probably benign
R8975:Rsf1	UTSW	7	97579908	unclassified	probably benign
R9033:Rsf1	UTSW	7	97579904	unclassified	probably benign
R9044:Rsf1	UTSW	7	97579904	unclassified	probably benign
R9060:Rsf1	UTSW	7	97579923	unclassified	probably benign
R9066:Rsf1	UTSW	7	97579911	unclassified	probably benign
R9079:Rsf1	UTSW	7	97579904	unclassified	probably benign
R9080:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R9094:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9096:Rsf1	UTSW	7	97579907	unclassified	probably benign
R9101:Rsf1	UTSW	7	97579907	unclassified	probably benign
R9102:Rsf1	UTSW	7	97579931	unclassified	probably benign
R9123:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9125:Rsf1	UTSW	7	97579908	unclassified	probably benign
R9126:Rsf1	UTSW	7	97579908	unclassified	probably benign
R9128:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9157:Rsf1	UTSW	7	97579906	unclassified	probably benign
R9159:Rsf1	UTSW	7	97579908	unclassified	probably benign
R9161:Rsf1	UTSW	7	97579906	unclassified	probably benign
R9187:Rsf1	UTSW	7	97579933	unclassified	probably benign
R9240:Rsf1	UTSW	7	97579912	unclassified	probably benign
R9250:Rsf1	UTSW	7	97579914	unclassified	probably benign
R9257:Rsf1	UTSW	7	97685711	missense
R9288:Rsf1	UTSW	7	97579912	unclassified	probably benign
R9345:Rsf1	UTSW	7	97579932	unclassified	probably benign
R9406:Rsf1	UTSW	7	97579911	unclassified	probably benign
R9411:Rsf1	UTSW	7	97579904	start codon destroyed	probably null
R9414:Rsf1	UTSW	7	97664558	critical splice acceptor site	probably null
R9420:Rsf1	UTSW	7	97579927	unclassified	probably benign
R9421:Rsf1	UTSW	7	97579934	unclassified	probably benign
R9423:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9427:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9448:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9452:Rsf1	UTSW	7	97579926	unclassified	probably benign
R9454:Rsf1	UTSW	7	97579923	unclassified	probably benign
R9467:Rsf1	UTSW	7	97579913	unclassified	probably benign
R9468:Rsf1	UTSW	7	97579920	unclassified	probably benign
R9483:Rsf1	UTSW	7	97579930	unclassified	probably benign
R9488:Rsf1	UTSW	7	97579922	unclassified	probably benign
R9502:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9507:Rsf1	UTSW	7	97579934	unclassified	probably benign
R9509:Rsf1	UTSW	7	97579920	unclassified	probably benign
R9519:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9526:Rsf1	UTSW	7	97579932	unclassified	probably benign
R9537:Rsf1	UTSW	7	97579914	unclassified	probably benign
R9581:Rsf1	UTSW	7	97579918	unclassified	probably benign
R9590:Rsf1	UTSW	7	97579911	unclassified	probably benign
R9592:Rsf1	UTSW	7	97579911	unclassified	probably benign
R9618:Rsf1	UTSW	7	97579909	unclassified	probably benign
R9630:Rsf1	UTSW	7	97579906	unclassified	probably benign
R9685:Rsf1	UTSW	7	97579932	unclassified	probably benign
R9716:Rsf1	UTSW	7	97579932	unclassified	probably benign
R9748:Rsf1	UTSW	7	97579906	unclassified	probably benign
R9774:Rsf1	UTSW	7	97579931	unclassified	probably benign
R9795:Rsf1	UTSW	7	97579904	unclassified	probably benign
R9802:Rsf1	UTSW	7	97579906	unclassified	probably benign
RF034:Rsf1	UTSW	7	97579908	unclassified	probably benign
RF036:Rsf1	UTSW	7	97579908	unclassified	probably benign
X0025:Rsf1	UTSW	7	97636444	missense	probably damaging	1.00
X0028:Rsf1	UTSW	7	97660824	nonsense	probably null
Y4335:Rsf1	UTSW	7	97579904	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- GAATCCTTCTGCTTTCCTGTGTAG -3'
(R):5'- GGCTTTGTAGTTATAAAGACAATAGGA -3'

Sequencing Primer
(F):5'- AGTCGTGTGTGAACCATACC -3'
(R):5'- GAGACAGTTTGTTCAGTGT -3'

Posted On

2020-01-23