Incidental Mutation 'R8111:Mgat4d'
ID630878
Institutional Source Beutler Lab
Gene Symbol Mgat4d
Ensembl Gene ENSMUSG00000035057
Gene NameMGAT4 family, member C
Synonyms4933434I20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8111 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location83348471-83382320 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83368147 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 271 (N271I)
Ref Sequence ENSEMBL: ENSMUSP00000041629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038692]
Predicted Effect probably damaging
Transcript: ENSMUST00000038692
AA Change: N271I

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041629
Gene: ENSMUSG00000035057
AA Change: N271I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_transf_54 70 373 5.9e-120 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,660,309 W1233* probably null Het
4930590J08Rik A G 6: 91,917,710 I247V probably benign Het
8030423J24Rik T A 13: 70,883,958 C50S unknown Het
Adam29 T G 8: 55,871,550 H623P probably benign Het
Adamts5 A G 16: 85,899,315 V318A probably damaging Het
Ano3 T C 2: 110,783,713 D215G possibly damaging Het
Ap3b2 A G 7: 81,463,782 I893T unknown Het
Apob G A 12: 8,008,801 A2428T probably benign Het
Armc3 T C 2: 19,296,863 V660A probably benign Het
Atf7 G T 15: 102,563,334 T42K probably damaging Het
Atg9a A T 1: 75,187,722 I160N probably damaging Het
Atp2b1 T C 10: 98,996,924 V429A possibly damaging Het
Bpifb3 A C 2: 153,922,689 H167P probably benign Het
Cacna1f G T X: 7,621,087 E921D probably damaging Het
Ccdc57 T A 11: 120,878,887 L713F probably damaging Het
Chd1l C T 3: 97,587,210 E385K possibly damaging Het
Csmd1 C T 8: 15,917,306 V3186I probably benign Het
Dclre1c T A 2: 3,447,148 D349E probably benign Het
Dlg1 C T 16: 31,842,802 T657M possibly damaging Het
Dync2h1 T C 9: 7,148,688 I919V probably benign Het
Eml5 A G 12: 98,792,514 probably null Het
Epas1 C A 17: 86,818,432 S286* probably null Het
Fat1 G A 8: 45,026,058 V2714I possibly damaging Het
Fuca2 T C 10: 13,514,801 M447T probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm11110 A C 17: 57,103,427 C24G probably null Het
Gm6176 T A 7: 22,051,168 I113F probably benign Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpat2 G T 2: 127,433,857 L518F probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Hgsnat C T 8: 25,968,412 V195I probably benign Het
Hivep3 T A 4: 120,098,386 S1300T probably damaging Het
Hs3st2 A T 7: 121,393,139 H137L probably damaging Het
Iffo1 T C 6: 125,145,818 S188P possibly damaging Het
Itih1 T C 14: 30,932,268 D684G probably damaging Het
Lrba C A 3: 86,327,705 N852K probably damaging Het
Lrriq4 T C 3: 30,655,781 S425P possibly damaging Het
Mdn1 T A 4: 32,674,003 S562T possibly damaging Het
Mex3a T C 3: 88,536,757 V380A probably benign Het
Mmp24 T A 2: 155,807,425 V254E possibly damaging Het
Muc16 T A 9: 18,592,629 R6455S possibly damaging Het
Npffr1 T A 10: 61,623,349 V127E probably damaging Het
Obox5 T A 7: 15,758,616 N165K probably damaging Het
Olfr1513 G A 14: 52,349,887 T53M possibly damaging Het
Otulin A C 15: 27,606,295 V344G probably damaging Het
Pappa A G 4: 65,261,992 D1030G probably damaging Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Ppp2r3c C A 12: 55,297,849 M111I probably benign Het
Prss37 T C 6: 40,517,813 T13A probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sgo2b T A 8: 63,943,104 K39N probably damaging Het
Sike1 T C 3: 103,001,807 *208Q probably null Het
Spire1 A G 18: 67,519,321 S229P probably damaging Het
Tmem132b A G 5: 125,622,793 I132V probably benign Het
Umodl1 T C 17: 30,971,818 V213A probably damaging Het
Washc1 C G 17: 66,116,038 Q116E probably benign Het
Wdr34 C A 2: 30,031,847 A501S possibly damaging Het
Zfp553 T A 7: 127,236,921 C549* probably null Het
Zfp9 G A 6: 118,464,600 P367L probably damaging Het
Other mutations in Mgat4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Mgat4d APN 8 83354796 missense probably benign 0.21
IGL01634:Mgat4d APN 8 83368116 missense possibly damaging 0.71
IGL01987:Mgat4d APN 8 83368102 missense probably damaging 1.00
IGL02084:Mgat4d APN 8 83368981 missense possibly damaging 0.72
R0546:Mgat4d UTSW 8 83355721 missense possibly damaging 0.94
R1322:Mgat4d UTSW 8 83365725 missense possibly damaging 0.74
R1526:Mgat4d UTSW 8 83369037 missense probably benign 0.25
R1617:Mgat4d UTSW 8 83365711 missense probably damaging 1.00
R2223:Mgat4d UTSW 8 83355672 splice site probably benign
R3157:Mgat4d UTSW 8 83354821 missense probably benign
R3421:Mgat4d UTSW 8 83358143 missense probably damaging 1.00
R3422:Mgat4d UTSW 8 83358143 missense probably damaging 1.00
R4387:Mgat4d UTSW 8 83371706 missense probably damaging 1.00
R4796:Mgat4d UTSW 8 83358120 missense probably damaging 1.00
R4805:Mgat4d UTSW 8 83358158 splice site probably null
R5054:Mgat4d UTSW 8 83368208 splice site probably null
R6366:Mgat4d UTSW 8 83368951 splice site probably null
R6927:Mgat4d UTSW 8 83354867 missense probably benign 0.03
R7053:Mgat4d UTSW 8 83371632 missense probably damaging 0.98
R7554:Mgat4d UTSW 8 83355773 missense probably benign 0.00
R7566:Mgat4d UTSW 8 83358023 missense probably damaging 1.00
Z1176:Mgat4d UTSW 8 83348521 missense probably benign 0.04
Z1176:Mgat4d UTSW 8 83368112 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CATCTCATCCAAGACATTTTCAGTG -3'
(R):5'- AGGTGCATACTCATAGCGC -3'

Sequencing Primer
(F):5'- CAGTGAATTCTAGCCAAAGTACTG -3'
(R):5'- GGTGGCATGCACCTATAATCCTAG -3'
Posted On2020-06-30