Mutagenetix > Incidental Mutations

Incidental Mutation 'R8111:Muc16'

630880

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R8111 (G1)

Quality Score

190.009

Status

Not validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 18592629 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 6455 (R6455S)

Ref Sequence

ENSEMBL: ENSMUSP00000147104 (fasta)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000208663
AA Change: R6455S

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 93.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	C	T	14: 32,660,309	W1233*	probably null	Het
4930590J08Rik	A	G	6: 91,917,710	I247V	probably benign	Het
8030423J24Rik	T	A	13: 70,883,958	C50S	unknown	Het
Adam29	T	G	8: 55,871,550	H623P	probably benign	Het
Adamts5	A	G	16: 85,899,315	V318A	probably damaging	Het
Ano3	T	C	2: 110,783,713	D215G	possibly damaging	Het
Ap3b2	A	G	7: 81,463,782	I893T	unknown	Het
Apob	G	A	12: 8,008,801	A2428T	probably benign	Het
Armc3	T	C	2: 19,296,863	V660A	probably benign	Het
Atf7	G	T	15: 102,563,334	T42K	probably damaging	Het
Atg9a	A	T	1: 75,187,722	I160N	probably damaging	Het
Atp2b1	T	C	10: 98,996,924	V429A	possibly damaging	Het
Bpifb3	A	C	2: 153,922,689	H167P	probably benign	Het
Cacna1f	G	T	X: 7,621,087	E921D	probably damaging	Het
Ccdc57	T	A	11: 120,878,887	L713F	probably damaging	Het
Chd1l	C	T	3: 97,587,210	E385K	possibly damaging	Het
Csmd1	C	T	8: 15,917,306	V3186I	probably benign	Het
Dclre1c	T	A	2: 3,447,148	D349E	probably benign	Het
Dlg1	C	T	16: 31,842,802	T657M	possibly damaging	Het
Dync2h1	T	C	9: 7,148,688	I919V	probably benign	Het
Eml5	A	G	12: 98,792,514		probably null	Het
Epas1	C	A	17: 86,818,432	S286*	probably null	Het
Fat1	G	A	8: 45,026,058	V2714I	possibly damaging	Het
Fuca2	T	C	10: 13,514,801	M447T	probably benign	Het
Gm10800	CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA	CAAGAAAACTGAAAATCA	2: 98,667,016		probably null	Het
Gm11110	A	C	17: 57,103,427	C24G	probably null	Het
Gm6176	T	A	7: 22,051,168	I113F	probably benign	Het
Gmcl1	G	T	6: 86,721,426	A163E	probably damaging	Het
Gpat2	G	T	2: 127,433,857	L518F	probably damaging	Het
Gpr137b	T	C	13: 13,359,406	Y355C	probably damaging	Het
Hgsnat	C	T	8: 25,968,412	V195I	probably benign	Het
Hivep3	T	A	4: 120,098,386	S1300T	probably damaging	Het
Hs3st2	A	T	7: 121,393,139	H137L	probably damaging	Het
Iffo1	T	C	6: 125,145,818	S188P	possibly damaging	Het
Itih1	T	C	14: 30,932,268	D684G	probably damaging	Het
Lrba	C	A	3: 86,327,705	N852K	probably damaging	Het
Lrriq4	T	C	3: 30,655,781	S425P	possibly damaging	Het
Mdn1	T	A	4: 32,674,003	S562T	possibly damaging	Het
Mex3a	T	C	3: 88,536,757	V380A	probably benign	Het
Mgat4d	A	T	8: 83,368,147	N271I	probably damaging	Het
Mmp24	T	A	2: 155,807,425	V254E	possibly damaging	Het
Npffr1	T	A	10: 61,623,349	V127E	probably damaging	Het
Obox5	T	A	7: 15,758,616	N165K	probably damaging	Het
Olfr1513	G	A	14: 52,349,887	T53M	possibly damaging	Het
Otulin	A	C	15: 27,606,295	V344G	probably damaging	Het
Pappa	A	G	4: 65,261,992	D1030G	probably damaging	Het
Pdzd2	G	A	15: 12,373,506	S2181L	probably benign	Het
Ppp2r3c	C	A	12: 55,297,849	M111I	probably benign	Het
Prss37	T	C	6: 40,517,813	T13A	probably benign	Het
Sfi1	TCGC	TC	11: 3,146,254		probably null	Het
Sgo2b	T	A	8: 63,943,104	K39N	probably damaging	Het
Sike1	T	C	3: 103,001,807	*208Q	probably null	Het
Spire1	A	G	18: 67,519,321	S229P	probably damaging	Het
Tmem132b	A	G	5: 125,622,793	I132V	probably benign	Het
Umodl1	T	C	17: 30,971,818	V213A	probably damaging	Het
Washc1	C	G	17: 66,116,038	Q116E	probably benign	Het
Wdr34	C	A	2: 30,031,847	A501S	possibly damaging	Het
Zfp553	T	A	7: 127,236,921	C549*	probably null	Het
Zfp9	G	A	6: 118,464,600	P367L	probably damaging	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R1695:Muc16	UTSW	9	18497433	missense	probably damaging	1.00
R3196:Muc16	UTSW	9	18497830	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6146:Muc16	UTSW	9	18497797	missense	probably damaging	0.98
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	splice site	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6286:Muc16	UTSW	9	18644389	missense	unknown
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6458:Muc16	UTSW	9	18641721	missense	probably benign	0.01
R6460:Muc16	UTSW	9	18640516	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	splice site	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6789:Muc16	UTSW	9	18559986	missense	probably benign	0.40
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6874:Muc16	UTSW	9	18658769	nonsense	probably null
R6894:Muc16	UTSW	9	18495576	missense	possibly damaging	0.92
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6919:Muc16	UTSW	9	18660299	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R6996:Muc16	UTSW	9	18645897	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7038:Muc16	UTSW	9	18620468	missense	probably damaging	0.99
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7070:Muc16	UTSW	9	18645923	nonsense	probably null
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7126:Muc16	UTSW	9	18641216	missense	probably benign	0.01
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7194:Muc16	UTSW	9	18674454	missense	unknown
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7213:Muc16	UTSW	9	18641416	missense	probably benign	0.01
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7265:Muc16	UTSW	9	18656472	missense	unknown
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00
R7581:Muc16	UTSW	9	18645614	missense	unknown
R7594:Muc16	UTSW	9	18645062	missense	unknown
R7629:Muc16	UTSW	9	18566785	missense	possibly damaging	0.86
R7664:Muc16	UTSW	9	18607722	missense	probably benign	0.08
R7666:Muc16	UTSW	9	18558427	missense	probably damaging	1.00
R7703:Muc16	UTSW	9	18605282	missense
R7727:Muc16	UTSW	9	18660242	missense	unknown
R7743:Muc16	UTSW	9	18657477	missense	unknown
R7744:Muc16	UTSW	9	18585096	critical splice acceptor site	probably null
R7761:Muc16	UTSW	9	18580574	missense	probably damaging	1.00
R7769:Muc16	UTSW	9	18660507	missense	unknown
R7805:Muc16	UTSW	9	18638493	missense	possibly damaging	0.94
R7827:Muc16	UTSW	9	18595223	missense	possibly damaging	0.83
R7845:Muc16	UTSW	9	18640773	missense	probably benign	0.01
R7849:Muc16	UTSW	9	18640505	missense	probably benign	0.01
R7884:Muc16	UTSW	9	18642694	missense	unknown
R7885:Muc16	UTSW	9	18639464	missense	probably benign	0.10
R7886:Muc16	UTSW	9	18585982	missense	probably benign	0.03
R7899:Muc16	UTSW	9	18640697	missense	probably benign	0.01
R7904:Muc16	UTSW	9	18655650	missense	unknown
R7921:Muc16	UTSW	9	18659318	missense	unknown
R7922:Muc16	UTSW	9	18584825	missense	probably benign	0.16
R7948:Muc16	UTSW	9	18642490	missense	unknown
R7957:Muc16	UTSW	9	18643471	missense	unknown
R7972:Muc16	UTSW	9	18645764	nonsense	probably null
R7992:Muc16	UTSW	9	18656429	missense	unknown
R7998:Muc16	UTSW	9	18639892	missense	probably benign	0.04
R8014:Muc16	UTSW	9	18654875	missense	unknown
R8033:Muc16	UTSW	9	18636606	missense	probably benign	0.26
R8052:Muc16	UTSW	9	18659051	missense	unknown
R8058:Muc16	UTSW	9	18660002	nonsense	probably null
R8088:Muc16	UTSW	9	18519300	nonsense	probably null
R8095:Muc16	UTSW	9	18584830	nonsense	probably null
R8116:Muc16	UTSW	9	18658737	missense	unknown
R8117:Muc16	UTSW	9	18508910	nonsense	probably null
R8137:Muc16	UTSW	9	18645676	missense	unknown
R8196:Muc16	UTSW	9	18645334	missense	unknown
R8218:Muc16	UTSW	9	18637019	missense	possibly damaging	0.48
R8285:Muc16	UTSW	9	18642977	missense	unknown
R8313:Muc16	UTSW	9	18525147	missense	possibly damaging	0.85
R8317:Muc16	UTSW	9	18658043	missense	unknown
R8342:Muc16	UTSW	9	18658685	missense	unknown
Z1177:Muc16	UTSW	9	18537571	missense	probably benign	0.26
Z1177:Muc16	UTSW	9	18657861	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AATACAGGGCTCCGACACTG -3'
(R):5'- TGCAAGAACATGAACACAGCTG -3'

Sequencing Primer
(F):5'- TATCCTCAGCTGTGGAAAAAGGTC -3'
(R):5'- TGATCCCCCAAGCTAAAGTTCAGAG -3'

Posted On

2020-06-30