Incidental Mutation 'R8165:Lin54'
ID633713
Institutional Source Beutler Lab
Gene Symbol Lin54
Ensembl Gene ENSMUSG00000035310
Gene Namelin-54 homolog (C. elegans)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R8165 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location100441918-100500639 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100454499 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 393 (V393A)
Ref Sequence ENSEMBL: ENSMUSP00000041374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046154] [ENSMUST00000123572] [ENSMUST00000137750] [ENSMUST00000139234] [ENSMUST00000144030] [ENSMUST00000149714] [ENSMUST00000152387] [ENSMUST00000154921]
Predicted Effect probably benign
Transcript: ENSMUST00000046154
AA Change: V393A

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000041374
Gene: ENSMUSG00000035310
AA Change: V393A

DomainStartEndE-ValueType
low complexity region 364 382 N/A INTRINSIC
low complexity region 404 419 N/A INTRINSIC
CXC 520 560 3.06e-15 SMART
CXC 594 635 1.84e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123572
AA Change: V393A

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123425
Gene: ENSMUSG00000035310
AA Change: V393A

DomainStartEndE-ValueType
low complexity region 364 382 N/A INTRINSIC
low complexity region 404 419 N/A INTRINSIC
CXC 520 560 3.06e-15 SMART
CXC 594 635 1.84e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137750
AA Change: V172A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000120644
Gene: ENSMUSG00000035310
AA Change: V172A

DomainStartEndE-ValueType
low complexity region 143 161 N/A INTRINSIC
low complexity region 183 198 N/A INTRINSIC
CXC 299 339 3.06e-15 SMART
CXC 373 414 1.84e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139234
SMART Domains Protein: ENSMUSP00000119322
Gene: ENSMUSG00000035310

DomainStartEndE-ValueType
low complexity region 218 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144030
Predicted Effect probably benign
Transcript: ENSMUST00000149714
AA Change: V172A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000123544
Gene: ENSMUSG00000035310
AA Change: V172A

DomainStartEndE-ValueType
low complexity region 143 161 N/A INTRINSIC
low complexity region 183 198 N/A INTRINSIC
CXC 299 339 3.06e-15 SMART
CXC 373 414 1.84e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152387
AA Change: V304A

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121902
Gene: ENSMUSG00000035310
AA Change: V304A

DomainStartEndE-ValueType
low complexity region 218 231 N/A INTRINSIC
low complexity region 275 293 N/A INTRINSIC
low complexity region 315 330 N/A INTRINSIC
CXC 431 471 3.06e-15 SMART
CXC 505 546 1.84e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154921
AA Change: V172A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000121137
Gene: ENSMUSG00000035310
AA Change: V172A

DomainStartEndE-ValueType
low complexity region 143 161 N/A INTRINSIC
low complexity region 183 198 N/A INTRINSIC
CXC 299 339 3.06e-15 SMART
CXC 373 414 1.84e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LIN54 is a component of the LIN, or DREAM, complex, an essential regulator of cell cycle genes (Schmit et al., 2009 [PubMed 19725879]).[supplied by OMIM, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C A 5: 63,897,946 probably null Het
1110037F02Rik T A 4: 11,542,128 D1521E probably benign Het
Amph A G 13: 19,094,837 K161E probably benign Het
Aox2 A T 1: 58,308,929 H602L probably benign Het
Areg A G 5: 91,143,633 N145S probably damaging Het
Arhgap29 C T 3: 121,988,573 T142I probably damaging Het
Bcar3 C T 3: 122,511,156 probably benign Het
Brpf3 C T 17: 28,806,274 A107V probably benign Het
Btnl2 T A 17: 34,368,708 S509T possibly damaging Het
Cacna2d2 A G 9: 107,525,454 probably null Het
Casz1 C T 4: 148,944,431 P1111L probably damaging Het
Ccdc91 C T 6: 147,631,588 T411I unknown Het
Chd9 A C 8: 91,041,141 E2422A probably damaging Het
Clrn3 T C 7: 135,528,404 I34V probably benign Het
Cnksr3 C T 10: 7,154,467 D79N probably damaging Het
Cops8 A G 1: 90,612,007 probably null Het
Cpa2 A G 6: 30,564,346 K392R probably benign Het
Dnajc28 G A 16: 91,616,907 R150* probably null Het
Dnase1l3 T C 14: 7,994,299 probably benign Het
Fam65a C A 8: 105,620,888 L1028M unknown Het
Gdpd5 A T 7: 99,456,482 T502S probably benign Het
Gp2 A T 7: 119,450,152 D387E probably damaging Het
Gpr179 A G 11: 97,351,538 L160P probably benign Het
Hmcn1 G A 1: 150,646,658 T3497M probably benign Het
Idh3b T A 2: 130,280,500 T322S possibly damaging Het
Kit A T 5: 75,620,880 N323I possibly damaging Het
Kng2 T C 16: 22,987,496 S445G unknown Het
Lyst T A 13: 13,698,360 W2715R probably damaging Het
Mad1l1 T C 5: 140,315,058 T28A probably benign Het
Med7 T A 11: 46,441,246 C223S probably benign Het
Megf8 T A 7: 25,353,873 L1823Q probably damaging Het
Mga C A 2: 119,947,238 Q1755K probably benign Het
Mgat4b A T 11: 50,210,974 N22I probably benign Het
Ndufb6 C T 4: 40,270,665 probably null Het
Neil3 A G 8: 53,589,094 L490P probably benign Het
Nek9 C T 12: 85,303,643 V886I probably benign Het
Nol4l A T 2: 153,420,553 Y366* probably null Het
Nt5dc2 A G 14: 31,138,929 T354A probably damaging Het
Olfr339 T A 2: 36,421,703 Y102N probably damaging Het
Pde2a G A 7: 101,500,448 probably null Het
Phf1 T C 17: 26,937,070 F444L possibly damaging Het
Plin4 G A 17: 56,107,019 T202I possibly damaging Het
Plk4 G C 3: 40,813,574 V851L probably damaging Het
Pp2d1 A G 17: 53,515,229 S270P probably damaging Het
Scn9a A G 2: 66,540,530 F569L probably damaging Het
Sel1l2 T A 2: 140,262,706 L306F probably damaging Het
Spic A T 10: 88,677,566 S86T probably damaging Het
Stkld1 A G 2: 26,946,656 N278S probably benign Het
Taar7d T A 10: 24,027,597 F126I probably benign Het
Tbc1d31 A G 15: 57,960,949 E869G possibly damaging Het
Tbcd C T 11: 121,493,885 T315M probably benign Het
Terf2 T C 8: 107,083,024 K221E possibly damaging Het
Tex43 T A 18: 56,589,475 probably benign Het
Thsd7a T A 6: 12,468,963 T539S Het
Tll2 A G 19: 41,088,874 F818L possibly damaging Het
Tmem87a T C 2: 120,370,478 T427A possibly damaging Het
Ush2a C A 1: 188,451,755 Q1419K possibly damaging Het
Vill T A 9: 119,066,753 F511Y probably damaging Het
Vps13c A G 9: 67,858,790 D63G probably benign Het
Vrk2 A G 11: 26,535,575 F138L probably benign Het
Zfp710 T C 7: 80,086,027 I514T probably damaging Het
Zgrf1 T A 3: 127,563,383 F753I possibly damaging Het
Other mutations in Lin54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Lin54 APN 5 100485607 missense probably benign 0.03
IGL01356:Lin54 APN 5 100454017 missense probably damaging 0.98
IGL02931:Lin54 APN 5 100480321 missense possibly damaging 0.93
IGL03089:Lin54 APN 5 100450993 missense probably damaging 1.00
IGL03095:Lin54 APN 5 100454478 missense probably damaging 0.99
IGL03202:Lin54 APN 5 100475814 missense possibly damaging 0.92
R0505:Lin54 UTSW 5 100452293 missense probably damaging 0.98
R1138:Lin54 UTSW 5 100444134 missense probably damaging 0.98
R1540:Lin54 UTSW 5 100480250 missense probably damaging 0.99
R1719:Lin54 UTSW 5 100485249 missense possibly damaging 0.91
R1991:Lin54 UTSW 5 100485801 critical splice donor site probably null
R2698:Lin54 UTSW 5 100480250 missense probably damaging 0.99
R3738:Lin54 UTSW 5 100459806 splice site probably benign
R4238:Lin54 UTSW 5 100475744 missense possibly damaging 0.45
R4424:Lin54 UTSW 5 100446560 missense probably damaging 0.98
R4529:Lin54 UTSW 5 100446560 missense possibly damaging 0.91
R4530:Lin54 UTSW 5 100446560 missense possibly damaging 0.91
R4531:Lin54 UTSW 5 100446560 missense possibly damaging 0.91
R4532:Lin54 UTSW 5 100446560 missense possibly damaging 0.91
R4533:Lin54 UTSW 5 100485403 missense possibly damaging 0.79
R4665:Lin54 UTSW 5 100453084 missense possibly damaging 0.92
R4784:Lin54 UTSW 5 100459738 missense probably damaging 0.99
R4785:Lin54 UTSW 5 100459738 missense probably damaging 0.99
R5252:Lin54 UTSW 5 100480204 missense probably benign
R5265:Lin54 UTSW 5 100485519 missense probably damaging 1.00
R6545:Lin54 UTSW 5 100485137 splice site probably null
R7150:Lin54 UTSW 5 100485300 missense possibly damaging 0.74
R7544:Lin54 UTSW 5 100485270 missense possibly damaging 0.84
X0025:Lin54 UTSW 5 100454443 missense probably benign 0.11
X0026:Lin54 UTSW 5 100450999 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGCTGGCTGGTAGTTACAA -3'
(R):5'- CCTCAGATTCATATTGCTGGGG -3'

Sequencing Primer
(F):5'- AAGTCTGACTCAGAGATCTGCCTG -3'
(R):5'- ACTCATTATGTAAGTCAGGCTGGCC -3'
Posted On2020-07-13