Incidental Mutation 'R8197:Cntnap4'
ID 635496
Institutional Source Beutler Lab
Gene Symbol Cntnap4
Ensembl Gene ENSMUSG00000031772
Gene Name contactin associated protein-like 4
Synonyms Caspr4, E130114F09Rik
MMRRC Submission 067620-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R8197 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 113296675-113609349 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 113296857 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 31 (Y31N)
Ref Sequence ENSEMBL: ENSMUSP00000034225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034225] [ENSMUST00000118171]
AlphaFold Q99P47
Predicted Effect probably benign
Transcript: ENSMUST00000034225
AA Change: Y31N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000034225
Gene: ENSMUSG00000031772
AA Change: Y31N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 32 179 2.35e-19 SMART
LamG 206 343 5.14e-25 SMART
LamG 392 526 1.04e-25 SMART
EGF 554 588 1.4e0 SMART
Blast:FBG 591 775 1e-120 BLAST
LamG 815 942 1.01e-32 SMART
EGF 963 999 1.36e1 SMART
LamG 1040 1178 7.8e-16 SMART
transmembrane domain 1244 1266 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118171
AA Change: Y31N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000112511
Gene: ENSMUSG00000031772
AA Change: Y31N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 32 179 2.35e-19 SMART
LamG 206 343 5.14e-25 SMART
LamG 392 526 1.04e-25 SMART
EGF 554 588 1.4e0 SMART
Blast:FBG 591 775 1e-120 BLAST
LamG 815 942 1.01e-32 SMART
EGF 963 999 1.36e1 SMART
LamG 1040 1178 2.06e-15 SMART
transmembrane domain 1244 1266 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin protein family. Members of this family function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. This protein may also play a role in proper neurotransmission in the dopaminergic and GABAergic systems and mutations in this gene may be associated with certain psychiatric illnesses. A polymorphism in an intron of this gene may be associated with longevity. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous knock-out mice show increased midbrain dopaminergic release in the nucleus accumbens, synaptic defects, impaired sensory-motor gating, and increased grooming behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars1 T A 8: 111,780,628 (GRCm39) D836E probably benign Het
Abca6 A C 11: 110,102,641 (GRCm39) L861R probably damaging Het
Adamts18 G T 8: 114,481,227 (GRCm39) A560E probably damaging Het
Adra2b A T 2: 127,206,578 (GRCm39) Q365L possibly damaging Het
Anxa3 A G 5: 96,982,651 (GRCm39) T250A probably benign Het
B4galt5 T A 2: 167,144,023 (GRCm39) N309I probably benign Het
Bub1 G T 2: 127,643,177 (GRCm39) R1056S probably damaging Het
Ccdc185 G T 1: 182,576,324 (GRCm39) P122T possibly damaging Het
Cdk5rap3 A G 11: 96,806,975 (GRCm39) probably null Het
Crygc T C 1: 65,112,365 (GRCm39) M70V probably benign Het
Dnah14 A G 1: 181,517,666 (GRCm39) E2000G possibly damaging Het
Dpp4 T C 2: 62,203,171 (GRCm39) N266S probably benign Het
Edrf1 T A 7: 133,249,088 (GRCm39) D304E probably benign Het
Fabp9 T G 3: 10,259,887 (GRCm39) K42T probably benign Het
Fhl4 T A 10: 84,934,101 (GRCm39) I227F probably damaging Het
Gm13941 T C 2: 110,926,921 (GRCm39) probably null Het
Gsdmd T C 15: 75,736,186 (GRCm39) I105T possibly damaging Het
Gys1 A G 7: 45,092,348 (GRCm39) D317G possibly damaging Het
Hrh4 A G 18: 13,154,986 (GRCm39) Y175C probably damaging Het
Igfals A G 17: 25,099,278 (GRCm39) N123S probably benign Het
Igkv5-37 A G 6: 69,940,841 (GRCm39) V2A possibly damaging Het
Iqsec3 A G 6: 121,389,971 (GRCm39) L500P unknown Het
Itgae G A 11: 73,011,210 (GRCm39) R660Q probably benign Het
Kcnip2 T C 19: 45,782,730 (GRCm39) I204V possibly damaging Het
Kndc1 A G 7: 139,493,447 (GRCm39) E471G probably damaging Het
Lrrtm3 T A 10: 63,924,295 (GRCm39) T291S possibly damaging Het
Mast1 T A 8: 85,639,450 (GRCm39) H1293L possibly damaging Het
Mrnip A G 11: 50,090,607 (GRCm39) E257G probably benign Het
Myo9b T C 8: 71,743,607 (GRCm39) Y223H probably damaging Het
Nab1 G A 1: 52,529,127 (GRCm39) R257* probably null Het
Ncapd3 C A 9: 26,997,329 (GRCm39) L1217I probably damaging Het
Or5h18 T A 16: 58,847,448 (GRCm39) D274V probably benign Het
Or8b54 G A 9: 38,686,577 (GRCm39) V9M noncoding transcript Het
Pde4d T A 13: 110,084,870 (GRCm39) I489N probably damaging Het
Pdyn C T 2: 129,530,277 (GRCm39) G131R probably benign Het
Qrich2 CACCTGCTTGCAACACACCAGGCTGAACTGGACCT CACCT 11: 116,347,861 (GRCm39) probably benign Het
Rps6ka1 T C 4: 133,592,673 (GRCm39) K276E possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,121 (GRCm39) probably benign Het
Scube2 T A 7: 109,407,684 (GRCm39) N752I possibly damaging Het
Scyl2 T C 10: 89,498,228 (GRCm39) I194V probably benign Het
Sec31b T G 19: 44,512,955 (GRCm39) R511S probably benign Het
Serpinb6d T C 13: 33,851,588 (GRCm39) F115S probably damaging Het
Skint6 T G 4: 112,752,040 (GRCm39) probably null Het
Supt16 G A 14: 52,411,542 (GRCm39) P614S possibly damaging Het
Tmem114 T C 16: 8,227,516 (GRCm39) I182M probably damaging Het
Vmn1r125 G A 7: 21,006,851 (GRCm39) V250I probably damaging Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Zfp1005 A T 2: 150,109,577 (GRCm39) H89L possibly damaging Het
Zfp959 A T 17: 56,204,677 (GRCm39) D238V probably damaging Het
Other mutations in Cntnap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Cntnap4 APN 8 113,494,251 (GRCm39) splice site probably benign
IGL01898:Cntnap4 APN 8 113,582,939 (GRCm39) missense possibly damaging 0.46
IGL01918:Cntnap4 APN 8 113,478,866 (GRCm39) missense possibly damaging 0.67
IGL02257:Cntnap4 APN 8 113,343,126 (GRCm39) missense probably damaging 1.00
IGL02302:Cntnap4 APN 8 113,512,535 (GRCm39) splice site probably benign
IGL02621:Cntnap4 APN 8 113,537,355 (GRCm39) missense probably damaging 1.00
IGL03008:Cntnap4 APN 8 113,500,222 (GRCm39) missense probably benign 0.06
IGL03327:Cntnap4 APN 8 113,500,208 (GRCm39) missense probably benign 0.00
IGL03346:Cntnap4 APN 8 113,500,208 (GRCm39) missense probably benign 0.00
R0025:Cntnap4 UTSW 8 113,529,796 (GRCm39) missense probably damaging 1.00
R0025:Cntnap4 UTSW 8 113,529,796 (GRCm39) missense probably damaging 1.00
R0058:Cntnap4 UTSW 8 113,512,416 (GRCm39) missense probably damaging 0.98
R0310:Cntnap4 UTSW 8 113,569,148 (GRCm39) critical splice acceptor site probably null
R0363:Cntnap4 UTSW 8 113,583,143 (GRCm39) nonsense probably null
R0497:Cntnap4 UTSW 8 113,296,783 (GRCm39) missense probably benign 0.00
R1495:Cntnap4 UTSW 8 113,608,395 (GRCm39) missense possibly damaging 0.81
R1579:Cntnap4 UTSW 8 113,608,462 (GRCm39) missense possibly damaging 0.89
R1704:Cntnap4 UTSW 8 113,484,155 (GRCm39) missense probably damaging 1.00
R1943:Cntnap4 UTSW 8 113,542,128 (GRCm39) missense probably benign 0.10
R2160:Cntnap4 UTSW 8 113,484,203 (GRCm39) missense probably damaging 1.00
R2226:Cntnap4 UTSW 8 113,542,120 (GRCm39) missense probably damaging 0.98
R3148:Cntnap4 UTSW 8 113,484,071 (GRCm39) missense probably damaging 1.00
R3916:Cntnap4 UTSW 8 113,602,165 (GRCm39) missense probably benign 0.02
R3917:Cntnap4 UTSW 8 113,602,165 (GRCm39) missense probably benign 0.02
R4097:Cntnap4 UTSW 8 113,478,939 (GRCm39) missense probably benign 0.03
R4348:Cntnap4 UTSW 8 113,480,554 (GRCm39) missense probably damaging 1.00
R4469:Cntnap4 UTSW 8 113,391,898 (GRCm39) missense probably damaging 1.00
R4530:Cntnap4 UTSW 8 113,584,842 (GRCm39) missense probably benign 0.32
R4531:Cntnap4 UTSW 8 113,537,240 (GRCm39) missense possibly damaging 0.90
R4586:Cntnap4 UTSW 8 113,537,342 (GRCm39) missense probably benign
R4611:Cntnap4 UTSW 8 113,500,371 (GRCm39) critical splice donor site probably null
R4675:Cntnap4 UTSW 8 113,512,468 (GRCm39) missense probably damaging 1.00
R4801:Cntnap4 UTSW 8 113,500,222 (GRCm39) missense possibly damaging 0.94
R4802:Cntnap4 UTSW 8 113,500,222 (GRCm39) missense possibly damaging 0.94
R5273:Cntnap4 UTSW 8 113,460,070 (GRCm39) missense probably damaging 1.00
R6114:Cntnap4 UTSW 8 113,568,385 (GRCm39) missense probably damaging 1.00
R6194:Cntnap4 UTSW 8 113,602,061 (GRCm39) missense probably damaging 1.00
R6222:Cntnap4 UTSW 8 113,569,353 (GRCm39) missense probably damaging 1.00
R6262:Cntnap4 UTSW 8 113,529,843 (GRCm39) missense probably damaging 0.99
R6276:Cntnap4 UTSW 8 113,478,921 (GRCm39) missense possibly damaging 0.94
R6483:Cntnap4 UTSW 8 113,484,105 (GRCm39) missense possibly damaging 0.82
R6819:Cntnap4 UTSW 8 113,529,858 (GRCm39) missense probably benign 0.03
R7031:Cntnap4 UTSW 8 113,584,874 (GRCm39) missense probably benign 0.01
R7107:Cntnap4 UTSW 8 113,542,120 (GRCm39) missense probably damaging 0.98
R7146:Cntnap4 UTSW 8 113,537,268 (GRCm39) missense probably damaging 1.00
R7192:Cntnap4 UTSW 8 113,608,432 (GRCm39) missense probably benign 0.05
R7232:Cntnap4 UTSW 8 113,391,731 (GRCm39) splice site probably null
R7348:Cntnap4 UTSW 8 113,391,909 (GRCm39) missense probably damaging 1.00
R7482:Cntnap4 UTSW 8 113,460,194 (GRCm39) critical splice donor site probably null
R7832:Cntnap4 UTSW 8 113,484,113 (GRCm39) missense probably benign
R7895:Cntnap4 UTSW 8 113,478,829 (GRCm39) missense probably damaging 0.99
R8014:Cntnap4 UTSW 8 113,480,577 (GRCm39) missense probably damaging 0.99
R8185:Cntnap4 UTSW 8 113,391,897 (GRCm39) missense probably damaging 1.00
R8287:Cntnap4 UTSW 8 113,585,775 (GRCm39) missense probably damaging 1.00
R8299:Cntnap4 UTSW 8 113,500,324 (GRCm39) missense probably damaging 1.00
R8498:Cntnap4 UTSW 8 113,602,211 (GRCm39) missense possibly damaging 0.52
R8699:Cntnap4 UTSW 8 113,484,228 (GRCm39) missense probably damaging 1.00
R8774:Cntnap4 UTSW 8 113,529,820 (GRCm39) missense probably benign 0.01
R8774-TAIL:Cntnap4 UTSW 8 113,529,820 (GRCm39) missense probably benign 0.01
R8872:Cntnap4 UTSW 8 113,585,759 (GRCm39) missense possibly damaging 0.79
R8895:Cntnap4 UTSW 8 113,479,598 (GRCm39) missense probably benign 0.40
R8965:Cntnap4 UTSW 8 113,479,646 (GRCm39) missense probably damaging 1.00
R9189:Cntnap4 UTSW 8 113,602,600 (GRCm39) missense possibly damaging 0.92
R9260:Cntnap4 UTSW 8 113,500,276 (GRCm39) missense probably benign 0.08
R9474:Cntnap4 UTSW 8 113,460,103 (GRCm39) missense probably damaging 0.99
R9565:Cntnap4 UTSW 8 113,582,982 (GRCm39) missense probably benign 0.43
R9625:Cntnap4 UTSW 8 113,602,181 (GRCm39) missense possibly damaging 0.82
R9629:Cntnap4 UTSW 8 113,568,349 (GRCm39) missense probably damaging 1.00
R9745:Cntnap4 UTSW 8 113,391,808 (GRCm39) missense possibly damaging 0.89
R9765:Cntnap4 UTSW 8 113,568,496 (GRCm39) missense probably damaging 0.97
R9765:Cntnap4 UTSW 8 113,484,110 (GRCm39) missense probably benign 0.00
R9793:Cntnap4 UTSW 8 113,608,357 (GRCm39) missense probably benign 0.00
R9795:Cntnap4 UTSW 8 113,608,357 (GRCm39) missense probably benign 0.00
X0025:Cntnap4 UTSW 8 113,585,775 (GRCm39) missense probably damaging 1.00
X0063:Cntnap4 UTSW 8 113,602,211 (GRCm39) missense probably benign 0.05
Z1088:Cntnap4 UTSW 8 113,542,152 (GRCm39) missense probably damaging 1.00
Z1176:Cntnap4 UTSW 8 113,584,821 (GRCm39) missense possibly damaging 0.70
Z1186:Cntnap4 UTSW 8 113,479,002 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAAGACCCAGTCAGTGCTG -3'
(R):5'- TTAATGACCTCAAGACAGGCG -3'

Sequencing Primer
(F):5'- TCAGTGCTGGGTGAAGGAC -3'
(R):5'- GCAGCGATTCCAGTTGAA -3'
Posted On 2020-07-13