Mutagenetix > Incidental Mutation

Incidental Mutation 'R8014:Cntnap4'

617071

Institutional Source

Beutler Lab

Gene Symbol

Cntnap4

Ensembl Gene

ENSMUSG00000031772

Gene Name

contactin associated protein-like 4

Synonyms

E130114F09Rik, Caspr4

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.065) question?

Stock #

R8014 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

112570043-112882717 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 112753945 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 341 (N341K)

Ref Sequence

ENSEMBL: ENSMUSP00000034225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034225] [ENSMUST00000118171]

AlphaFold

Q99P47

Predicted Effect

probably damaging
Transcript: ENSMUST00000034225
AA Change: N341K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000034225
Gene: ENSMUSG00000031772
AA Change: N341K

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	7.8e-16	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000118171
AA Change: N341K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000112511
Gene: ENSMUSG00000031772
AA Change: N341K

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	2.06e-15	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin protein family. Members of this family function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. This protein may also play a role in proper neurotransmission in the dopaminergic and GABAergic systems and mutations in this gene may be associated with certain psychiatric illnesses. A polymorphism in an intron of this gene may be associated with longevity. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous knock-out mice show increased midbrain dopaminergic release in the nucleus accumbens, synaptic defects, impaired sensory-motor gating, and increased grooming behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030458C11Rik	C	A	15: 12,824,529	D7Y	probably benign	Het
9530053A07Rik	G	A	7: 28,137,541	R295H	probably benign	Het
Aff1	A	G	5: 103,833,869	T625A	possibly damaging	Het
Aldh8a1	T	C	10: 21,389,302	V276A	probably benign	Het
Alkbh3	T	C	2: 94,001,513	D124G	probably benign	Het
Apob	T	A	12: 8,010,798	N3093K	possibly damaging	Het
Atp13a1	C	T	8: 69,799,779	R608*	probably null	Het
Bbs7	A	T	3: 36,594,387	I404K	probably damaging	Het
BC030867	A	G	11: 102,257,899	N379D	probably benign	Het
Cacna2d1	A	T	5: 16,342,691	T647S	possibly damaging	Het
Carmil1	T	C	13: 24,036,321	E1140G	possibly damaging	Het
Ccdc158	C	A	5: 92,649,030	E482D	probably damaging	Het
Ccdc92	A	T	5: 124,836,026	H146Q	probably damaging	Het
Cog1	A	G	11: 113,656,164	D528G	probably damaging	Het
Cttnbp2	G	C	6: 18,426,093	A762G	possibly damaging	Het
D130043K22Rik	A	T	13: 24,856,702	I36F	probably damaging	Het
Dis3	T	A	14: 99,077,399	R954W	possibly damaging	Het
Ext1	T	C	15: 53,075,887	I589V	possibly damaging	Het
Fam20a	T	A	11: 109,685,506	E142D	possibly damaging	Het
Fars2	C	T	13: 36,205,085	Q186*	probably null	Het
Fhdc1	A	T	3: 84,474,639	M1K	probably null	Het
Gars	T	A	6: 55,073,407	F551Y	probably benign	Het
Gm28363	A	G	1: 117,726,804	R58G	probably benign	Het
Gm49333	A	T	16: 20,642,317	T618S	probably benign	Het
Gm8356	A	T	14: 6,536,303	N58K	probably damaging	Het
Gm9758	A	G	5: 14,911,440	V175A	possibly damaging	Het
Gpr182	T	C	10: 127,751,005	T26A	possibly damaging	Het
Gpr19	A	G	6: 134,869,473	Y416H	probably damaging	Het
Itgb7	T	A	15: 102,222,652	S322C	probably damaging	Het
Kcnma1	T	A	14: 23,373,143	I831F	probably benign	Het
Lrba	A	T	3: 86,417,971	D1912V	probably damaging	Het
Macf1	T	A	4: 123,526,826	T212S	probably benign	Het
Map3k4	A	T	17: 12,271,031	C504*	probably null	Het
Morc2a	T	C	11: 3,677,419	S281P	probably damaging	Het
Muc16	T	C	9: 18,654,875	H2116R	unknown	Het
Nrp2	C	T	1: 62,745,408	R239C	probably damaging	Het
Olfr1228	T	A	2: 89,248,999	I220F	probably damaging	Het
Olfr1264	C	A	2: 90,021,743	V108F	possibly damaging	Het
Olfr1469	A	T	19: 13,410,811	T81S	not run	Het
Olfr153	A	T	2: 87,532,164	M44L	probably benign	Het
Olfr155	T	A	4: 43,854,958	F216L	probably benign	Het
Olfr697	C	T	7: 106,741,617	V106I	probably benign	Het
Omg	T	C	11: 79,502,903	D43G	possibly damaging	Het
Pdia6	T	C	12: 17,273,965	L66S	probably damaging	Het
Pds5a	A	G	5: 65,627,739	I930T	possibly damaging	Het
Piezo2	C	T	18: 63,083,200	G1169S	probably benign	Het
Pkhd1	A	G	1: 20,508,891		probably null	Het
Plekhg1	A	T	10: 3,957,758	R947W		Het
Ptprs	A	C	17: 56,435,994	S383A	probably damaging	Het
Rin3	T	A	12: 102,361,371	L193*	probably null	Het
Sgsh	A	G	11: 119,352,695	V67A	probably damaging	Het
Slc16a4	A	G	3: 107,311,478	Y465C	probably damaging	Het
Stab2	C	A	10: 86,850,903	S2259I	possibly damaging	Het
Tbc1d24	G	A	17: 24,182,821	P385S	possibly damaging	Het
Tm4sf1	T	C	3: 57,292,898	I99V	probably benign	Het
Tmem108	A	T	9: 103,499,407	I281N	probably benign	Het
Usp31	T	C	7: 121,649,257	S988G	probably damaging	Het
Usp44	G	T	10: 93,852,709		probably null	Het
Zbtb26	T	A	2: 37,437,001		probably null	Het
Zfp599	A	G	9: 22,249,481	Y463H	probably benign	Het
Zfp750	T	A	11: 121,513,017	D344V	possibly damaging	Het
Zmym5	T	A	14: 56,794,426	K408N	possibly damaging	Het

Other mutations in Cntnap4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00847:Cntnap4	APN	8	112767619	splice site	probably benign
IGL01898:Cntnap4	APN	8	112856307	missense	possibly damaging	0.46
IGL01918:Cntnap4	APN	8	112752234	missense	possibly damaging	0.67
IGL02257:Cntnap4	APN	8	112616494	missense	probably damaging	1.00
IGL02302:Cntnap4	APN	8	112785903	splice site	probably benign
IGL02621:Cntnap4	APN	8	112810723	missense	probably damaging	1.00
IGL03008:Cntnap4	APN	8	112773590	missense	probably benign	0.06
IGL03327:Cntnap4	APN	8	112773576	missense	probably benign	0.00
IGL03346:Cntnap4	APN	8	112773576	missense	probably benign	0.00
R0025:Cntnap4	UTSW	8	112803164	missense	probably damaging	1.00
R0025:Cntnap4	UTSW	8	112803164	missense	probably damaging	1.00
R0058:Cntnap4	UTSW	8	112785784	missense	probably damaging	0.98
R0310:Cntnap4	UTSW	8	112842516	critical splice acceptor site	probably null
R0363:Cntnap4	UTSW	8	112856511	nonsense	probably null
R0497:Cntnap4	UTSW	8	112570151	missense	probably benign	0.00
R1495:Cntnap4	UTSW	8	112881763	missense	possibly damaging	0.81
R1579:Cntnap4	UTSW	8	112881830	missense	possibly damaging	0.89
R1704:Cntnap4	UTSW	8	112757523	missense	probably damaging	1.00
R1943:Cntnap4	UTSW	8	112815496	missense	probably benign	0.10
R2160:Cntnap4	UTSW	8	112757571	missense	probably damaging	1.00
R2226:Cntnap4	UTSW	8	112815488	missense	probably damaging	0.98
R3148:Cntnap4	UTSW	8	112757439	missense	probably damaging	1.00
R3916:Cntnap4	UTSW	8	112875533	missense	probably benign	0.02
R3917:Cntnap4	UTSW	8	112875533	missense	probably benign	0.02
R4097:Cntnap4	UTSW	8	112752307	missense	probably benign	0.03
R4348:Cntnap4	UTSW	8	112753922	missense	probably damaging	1.00
R4469:Cntnap4	UTSW	8	112665266	missense	probably damaging	1.00
R4530:Cntnap4	UTSW	8	112858210	missense	probably benign	0.32
R4531:Cntnap4	UTSW	8	112810608	missense	possibly damaging	0.90
R4586:Cntnap4	UTSW	8	112810710	missense	probably benign
R4611:Cntnap4	UTSW	8	112773739	critical splice donor site	probably null
R4675:Cntnap4	UTSW	8	112785836	missense	probably damaging	1.00
R4801:Cntnap4	UTSW	8	112773590	missense	possibly damaging	0.94
R4802:Cntnap4	UTSW	8	112773590	missense	possibly damaging	0.94
R5273:Cntnap4	UTSW	8	112733438	missense	probably damaging	1.00
R6114:Cntnap4	UTSW	8	112841753	missense	probably damaging	1.00
R6194:Cntnap4	UTSW	8	112875429	missense	probably damaging	1.00
R6222:Cntnap4	UTSW	8	112842721	missense	probably damaging	1.00
R6262:Cntnap4	UTSW	8	112803211	missense	probably damaging	0.99
R6276:Cntnap4	UTSW	8	112752289	missense	possibly damaging	0.94
R6483:Cntnap4	UTSW	8	112757473	missense	possibly damaging	0.82
R6819:Cntnap4	UTSW	8	112803226	missense	probably benign	0.03
R7031:Cntnap4	UTSW	8	112858242	missense	probably benign	0.01
R7107:Cntnap4	UTSW	8	112815488	missense	probably damaging	0.98
R7146:Cntnap4	UTSW	8	112810636	missense	probably damaging	1.00
R7192:Cntnap4	UTSW	8	112881800	missense	probably benign	0.05
R7232:Cntnap4	UTSW	8	112665099	splice site	probably null
R7348:Cntnap4	UTSW	8	112665277	missense	probably damaging	1.00
R7482:Cntnap4	UTSW	8	112733562	critical splice donor site	probably null
R7832:Cntnap4	UTSW	8	112757481	missense	probably benign
R7895:Cntnap4	UTSW	8	112752197	missense	probably damaging	0.99
R8185:Cntnap4	UTSW	8	112665265	missense	probably damaging	1.00
R8197:Cntnap4	UTSW	8	112570225	missense	probably benign	0.00
R8287:Cntnap4	UTSW	8	112859143	missense	probably damaging	1.00
R8299:Cntnap4	UTSW	8	112773692	missense	probably damaging	1.00
R8498:Cntnap4	UTSW	8	112875579	missense	possibly damaging	0.52
R8699:Cntnap4	UTSW	8	112757596	missense	probably damaging	1.00
R8774:Cntnap4	UTSW	8	112803188	missense	probably benign	0.01
R8774-TAIL:Cntnap4	UTSW	8	112803188	missense	probably benign	0.01
R8872:Cntnap4	UTSW	8	112859127	missense	possibly damaging	0.79
R8895:Cntnap4	UTSW	8	112752966	missense	probably benign	0.40
R8965:Cntnap4	UTSW	8	112753014	missense	probably damaging	1.00
R9189:Cntnap4	UTSW	8	112875968	missense	possibly damaging	0.92
R9260:Cntnap4	UTSW	8	112773644	missense	probably benign	0.08
R9474:Cntnap4	UTSW	8	112733471	missense	probably damaging	0.99
R9565:Cntnap4	UTSW	8	112856350	missense	probably benign	0.43
R9625:Cntnap4	UTSW	8	112875549	missense	possibly damaging	0.82
R9629:Cntnap4	UTSW	8	112841717	missense	probably damaging	1.00
R9745:Cntnap4	UTSW	8	112665176	missense	possibly damaging	0.89
R9765:Cntnap4	UTSW	8	112757478	missense	probably benign	0.00
R9765:Cntnap4	UTSW	8	112841864	missense	probably damaging	0.97
R9793:Cntnap4	UTSW	8	112881725	missense	probably benign	0.00
R9795:Cntnap4	UTSW	8	112881725	missense	probably benign	0.00
X0025:Cntnap4	UTSW	8	112859143	missense	probably damaging	1.00
X0063:Cntnap4	UTSW	8	112875579	missense	probably benign	0.05
Z1088:Cntnap4	UTSW	8	112815520	missense	probably damaging	1.00
Z1176:Cntnap4	UTSW	8	112858189	missense	possibly damaging	0.70
Z1186:Cntnap4	UTSW	8	112752370	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGTCACCCAAATGAAGACTGAATG -3'
(R):5'- CTCCTATATGCTTACTGTTAACCAGAG -3'

Sequencing Primer
(F):5'- GTTGTGAAGTTATCTACAGGATGAC -3'
(R):5'- CCAGAGAGAAATTTTAAAGAAGAGCC -3'

Posted On

2020-01-23