Mutagenetix > Incidental Mutation

Incidental Mutation 'R8275:Cyp2s1'

637939

Institutional Source

Beutler Lab

Gene Symbol

Cyp2s1

Ensembl Gene

ENSMUSG00000040703

Gene Name

cytochrome P450, family 2, subfamily s, polypeptide 1

Synonyms

1200011C15Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8275 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25802475-25816913 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 25809310 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 236 (T236S)

Ref Sequence

ENSEMBL: ENSMUSP00000041175 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043314] [ENSMUST00000108395] [ENSMUST00000156714]

AlphaFold

Q9DBX6

Predicted Effect

probably benign
Transcript: ENSMUST00000043314
AA Change: T236S

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000041175
Gene: ENSMUSG00000040703
AA Change: T236S

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
Pfam:p450	34	493	6.4e-122	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108395
AA Change: T236S

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000104032
Gene: ENSMUSG00000040703
AA Change: T236S

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
Pfam:p450	34	440	4e-108	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000156714

SMART Domains

Protein: ENSMUSP00000122264
Gene: ENSMUSG00000040703

Domain	Start	End	E-Value	Type
Pfam:p450	1	91	1.2e-13	PFAM

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. In rodents, the homologous protein has been shown to metabolize certain carcinogens; however, the specific function of the human protein has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and appear normal in terms of body weight, growth rate, organ weight, and daily activity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap2	T	C	4: 57,886,329		probably null	Het
Alx1	T	C	10: 103,028,389	D73G	probably benign	Het
Asah1	G	A	8: 41,348,122	H156Y	probably damaging	Het
Cgn	G	A	3: 94,774,953	L439F	possibly damaging	Het
Creb1	C	A	1: 64,558,528	T7K	probably benign	Het
Cyp2c54	T	A	19: 40,038,305	I469L	probably benign	Het
Duox1	T	C	2: 122,344,768	I1349T	probably benign	Het
Efhd2	C	T	4: 141,874,762	A36T	probably benign	Het
Espl1	G	A	15: 102,302,753		probably benign	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fat3	T	A	9: 16,246,750	Q1188L	probably damaging	Het
Flt1	A	T	5: 147,678,147	Y330N	probably damaging	Het
Golga4	A	T	9: 118,532,559	S202C	probably damaging	Het
Htr2b	C	T	1: 86,102,572	D134N	probably damaging	Het
Katna1	T	A	10: 7,752,810	C268S	probably damaging	Het
Lama4	T	C	10: 39,072,811	Y857H	probably damaging	Het
Lyst	T	C	13: 13,776,082	I3741T	probably benign	Het
Mcm4	T	C	16: 15,634,571	I233V	probably damaging	Het
Mettl22	T	C	16: 8,485,928	V286A	possibly damaging	Het
Nav3	C	A	10: 109,692,123	G1503V	noncoding transcript	Het
Obox1	T	A	7: 15,556,228	N165K	probably damaging	Het
Olfr744	T	A	14: 50,618,411	M63K	probably damaging	Het
Oxa1l	T	A	14: 54,363,301	I77N	possibly damaging	Het
Papss2	T	C	19: 32,638,360	L164P	probably damaging	Het
Pikfyve	T	A	1: 65,253,342		probably benign	Het
Polr2a	G	A	11: 69,748,056	R51C	probably damaging	Het
Rsph10b	C	G	5: 143,966,505	T606S	possibly damaging	Het
Siglecg	T	C	7: 43,412,468	V546A	probably benign	Het
Slc22a29	T	C	19: 8,169,317	S374G	probably benign	Het
Tia1	C	T	6: 86,427,736	Q318*	probably null	Het
Trpm2	T	A	10: 77,966,025	K69*	probably null	Het
Unc80	C	T	1: 66,640,614	R2115*	probably null	Het
Usp35	A	G	7: 97,314,819	S436P	probably damaging	Het
Vmn1r220	A	T	13: 23,184,313	L71*	probably null	Het
Vmn2r15	A	T	5: 109,286,284	D851E	probably benign	Het
Vps33a	A	T	5: 123,569,459	D148E	probably damaging	Het
Zfp729a	G	A	13: 67,620,104	H669Y	probably benign	Het
Zfp804b	C	T	5: 6,772,289	R258Q	probably benign	Het

Other mutations in Cyp2s1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Cyp2s1	APN	7	25809258	missense	probably damaging	1.00
IGL02415:Cyp2s1	APN	7	25808137	missense	probably damaging	1.00
IGL02530:Cyp2s1	APN	7	25816424	unclassified	probably benign
IGL02927:Cyp2s1	APN	7	25808152	missense	probably benign	0.17
IGL03358:Cyp2s1	APN	7	25808148	missense	probably damaging	1.00
R0139:Cyp2s1	UTSW	7	25811689	splice site	probably null
R0523:Cyp2s1	UTSW	7	25806050	missense	probably damaging	1.00
R0650:Cyp2s1	UTSW	7	25809258	missense	probably damaging	1.00
R0652:Cyp2s1	UTSW	7	25809258	missense	probably damaging	1.00
R0723:Cyp2s1	UTSW	7	25809548	missense	probably benign	0.01
R1086:Cyp2s1	UTSW	7	25805997	missense	probably damaging	1.00
R3732:Cyp2s1	UTSW	7	25803954	missense	probably null	0.08
R3732:Cyp2s1	UTSW	7	25803954	missense	probably null	0.08
R3733:Cyp2s1	UTSW	7	25803954	missense	probably null	0.08
R3813:Cyp2s1	UTSW	7	25805866	splice site	probably null
R3958:Cyp2s1	UTSW	7	25803954	missense	probably null	0.08
R4593:Cyp2s1	UTSW	7	25816442	unclassified	probably benign
R4965:Cyp2s1	UTSW	7	25809285	missense	possibly damaging	0.85
R5278:Cyp2s1	UTSW	7	25805884	missense	possibly damaging	0.95
R5642:Cyp2s1	UTSW	7	25816319	splice site	probably null
R6258:Cyp2s1	UTSW	7	25816442	unclassified	probably benign
R6628:Cyp2s1	UTSW	7	25815041	missense	probably benign	0.02
R6762:Cyp2s1	UTSW	7	25808070	missense	probably damaging	1.00
R7367:Cyp2s1	UTSW	7	25805973	missense	possibly damaging	0.90
R8145:Cyp2s1	UTSW	7	25808042	critical splice donor site	probably null
R9733:Cyp2s1	UTSW	7	25808104	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACCTAGGCCAGTAGTCAGTC -3'
(R):5'- GACGATAAAGAGTTCCAGGCTG -3'

Sequencing Primer
(F):5'- CCAGTAGTCAGTCAGTTGTACTCAAG -3'
(R):5'- TAAAGAGTTCCAGGCTGTGATCC -3'

Posted On

2020-07-28