Incidental Mutation 'R8275:Asah1'
ID637943
Institutional Source Beutler Lab
Gene Symbol Asah1
Ensembl Gene ENSMUSG00000031591
Gene NameN-acylsphingosine amidohydrolase 1
Synonymsacid ceramidase, 2310081N20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8275 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location41340197-41374773 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 41348122 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 156 (H156Y)
Ref Sequence ENSEMBL: ENSMUSP00000034000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034000] [ENSMUST00000110417]
Predicted Effect probably damaging
Transcript: ENSMUST00000034000
AA Change: H156Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034000
Gene: ENSMUSG00000031591
AA Change: H156Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:NAAA-beta 44 138 4.2e-35 PFAM
Pfam:CBAH 142 389 1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110417
SMART Domains Protein: ENSMUSP00000106047
Gene: ENSMUSG00000031591

DomainStartEndE-ValueType
Pfam:NAAA-beta 24 118 8.8e-39 PFAM
Pfam:CBAH 122 216 7.9e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: This gene encodes acid ceramidase, an enzyme that plays a central role in ceramide metabolism. The encoded protein undergoes proteolytic processing to generate a heterodimeric enzyme comprised of alpha and beta subunits that catalyzes the hydrolysis of sphingolipid ceramide into sphingosine and free fatty acid. The homozygous disruption of this gene leads to embryonic lethality in mice whereas the heterozygous animals exhibit a progressive lipid storage disease phenotype. [provided by RefSeq, Oct 2015]
PHENOTYPE: Nullizygous mutation of this gene causes embryonic lethality. Homozygotes for the P361R mutation die prematurely with growth defects, low acid ceramidase activity, high ceramide levels, histiocyte infiltrates into various organs, Farber bodies, short femur growth plates and altered ovary morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap2 T C 4: 57,886,329 probably null Het
Alx1 T C 10: 103,028,389 D73G probably benign Het
Cgn G A 3: 94,774,953 L439F possibly damaging Het
Creb1 C A 1: 64,558,528 T7K probably benign Het
Cyp2c54 T A 19: 40,038,305 I469L probably benign Het
Cyp2s1 T A 7: 25,809,310 T236S probably benign Het
Duox1 T C 2: 122,344,768 I1349T probably benign Het
Efhd2 C T 4: 141,874,762 A36T probably benign Het
Espl1 G A 15: 102,302,753 probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 T A 9: 16,246,750 Q1188L probably damaging Het
Flt1 A T 5: 147,678,147 Y330N probably damaging Het
Golga4 A T 9: 118,532,559 S202C probably damaging Het
Htr2b C T 1: 86,102,572 D134N probably damaging Het
Katna1 T A 10: 7,752,810 C268S probably damaging Het
Lama4 T C 10: 39,072,811 Y857H probably damaging Het
Lyst T C 13: 13,776,082 I3741T probably benign Het
Mcm4 T C 16: 15,634,571 I233V probably damaging Het
Mettl22 T C 16: 8,485,928 V286A possibly damaging Het
Nav3 C A 10: 109,692,123 G1503V noncoding transcript Het
Obox1 T A 7: 15,556,228 N165K probably damaging Het
Olfr744 T A 14: 50,618,411 M63K probably damaging Het
Oxa1l T A 14: 54,363,301 I77N possibly damaging Het
Papss2 T C 19: 32,638,360 L164P probably damaging Het
Pikfyve T A 1: 65,253,342 probably benign Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Rsph10b C G 5: 143,966,505 T606S possibly damaging Het
Siglecg T C 7: 43,412,468 V546A probably benign Het
Slc22a29 T C 19: 8,169,317 S374G probably benign Het
Tia1 C T 6: 86,427,736 Q318* probably null Het
Trpm2 T A 10: 77,966,025 K69* probably null Het
Unc80 C T 1: 66,640,614 R2115* probably null Het
Usp35 A G 7: 97,314,819 S436P probably damaging Het
Vmn1r220 A T 13: 23,184,313 L71* probably null Het
Vmn2r15 A T 5: 109,286,284 D851E probably benign Het
Vps33a A T 5: 123,569,459 D148E probably damaging Het
Zfp729a G A 13: 67,620,104 H669Y probably benign Het
Zfp804b C T 5: 6,772,289 R258Q probably benign Het
Other mutations in Asah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01824:Asah1 APN 8 41349543 unclassified probably benign
IGL02512:Asah1 APN 8 41360307 intron probably benign
IGL02523:Asah1 APN 8 41351947 missense probably benign
IGL03115:Asah1 APN 8 41360299 missense possibly damaging 0.94
IGL03357:Asah1 APN 8 41346196 splice site probably benign
PIT4366001:Asah1 UTSW 8 41343746 missense possibly damaging 0.94
R0593:Asah1 UTSW 8 41349582 missense probably benign 0.02
R1451:Asah1 UTSW 8 41354012 critical splice donor site probably null
R1977:Asah1 UTSW 8 41343517 critical splice donor site probably null
R2200:Asah1 UTSW 8 41343728 critical splice donor site probably null
R3429:Asah1 UTSW 8 41351888 unclassified probably benign
R4002:Asah1 UTSW 8 41348139 splice site probably benign
R4078:Asah1 UTSW 8 41354082 missense probably damaging 0.99
R4470:Asah1 UTSW 8 41343724 splice site probably null
R4471:Asah1 UTSW 8 41343724 splice site probably null
R4968:Asah1 UTSW 8 41354030 missense
R4970:Asah1 UTSW 8 41360277 nonsense probably null
R5643:Asah1 UTSW 8 41360295 missense possibly damaging 0.94
R5644:Asah1 UTSW 8 41360295 missense possibly damaging 0.94
R6128:Asah1 UTSW 8 41354055 missense probably damaging 1.00
R6419:Asah1 UTSW 8 41343766 missense probably damaging 1.00
R7059:Asah1 UTSW 8 41347069 missense probably damaging 0.96
R7442:Asah1 UTSW 8 41343565 missense possibly damaging 0.60
R7587:Asah1 UTSW 8 41374541 missense probably benign 0.43
R7663:Asah1 UTSW 8 41341627 missense probably damaging 0.98
R7980:Asah1 UTSW 8 41354030 missense
R8122:Asah1 UTSW 8 41343730 missense probably benign 0.01
R8700:Asah1 UTSW 8 41360275 missense probably benign 0.03
R8752:Asah1 UTSW 8 41360277 missense possibly damaging 0.47
R8960:Asah1 UTSW 8 41347024 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTAAGTGACTGAGACGCC -3'
(R):5'- AACGTGTGCTTGTAACACCAG -3'

Sequencing Primer
(F):5'- CCAGGTGCCTGCCTTTCTAAC -3'
(R):5'- GTGTGCTTGTAACACCAGTTTGAAC -3'
Posted On2020-07-28