Incidental Mutation 'R8356:Fmn1'
ID645755
Institutional Source Beutler Lab
Gene Symbol Fmn1
Ensembl Gene ENSMUSG00000044042
Gene Nameformin 1
SynonymsFmn, formin-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R8356 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location113327736-113716767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113365040 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 362 (T362A)
Ref Sequence ENSEMBL: ENSMUSP00000099606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099576] [ENSMUST00000102547] [ENSMUST00000161731]
Predicted Effect unknown
Transcript: ENSMUST00000099576
AA Change: T362A
SMART Domains Protein: ENSMUSP00000097171
Gene: ENSMUSG00000044042
AA Change: T362A

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1388 1.16e-137 SMART
Predicted Effect unknown
Transcript: ENSMUST00000102547
AA Change: T362A
SMART Domains Protein: ENSMUSP00000099606
Gene: ENSMUSG00000044042
AA Change: T362A

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1424 1.03e-134 SMART
Predicted Effect unknown
Transcript: ENSMUST00000161731
AA Change: T362A
SMART Domains Protein: ENSMUSP00000125052
Gene: ENSMUSG00000044042
AA Change: T362A

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 619 1e-62 BLAST
Blast:FH2 625 765 3e-53 BLAST
SCOP:d1jvr__ 796 827 2e-3 SMART
FH2 885 1290 1.16e-137 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the formin homology family and encodes a protein that has a role in the formation of adherens junction and the polymerization of linear actin cables. The homologous gene in mouse is associated with limb deformity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous, irradiation-induced, and transgene-insertional mutations show severe syndactyly and oligodactyly of the feet, abnormal long bones (including radius-ulna fusions), and reduced or absent kidneys. Many mutants survive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A G 10: 80,006,526 E1098G probably benign Het
Akap1 T A 11: 88,834,731 probably null Het
Arhgap26 T C 18: 39,111,848 V182A possibly damaging Het
Arhgef19 A G 4: 141,250,615 K545R probably benign Het
Asph C T 4: 9,537,722 R352Q probably benign Het
B3glct T A 5: 149,726,789 I119N probably damaging Het
Camsap3 C T 8: 3,600,679 R236* probably null Het
Ccser2 A T 14: 36,890,374 M792K probably benign Het
Ceacam5 C T 7: 17,745,699 T247I possibly damaging Het
Dnah9 A G 11: 66,156,938 S19P probably damaging Het
Dtwd1 A G 2: 126,158,531 E129G probably damaging Het
Ebf3 T A 7: 137,199,187 M490L probably benign Het
Erbb4 A G 1: 68,071,630 L1008S probably damaging Het
Ereg C T 5: 91,090,134 P160S possibly damaging Het
Exoc6b ATTT ATTTT 6: 84,844,095 probably null Het
Gm10436 T A 12: 88,177,216 T284S probably benign Het
Gm14326 A T 2: 177,948,519 D16E probably benign Het
H1foo A T 6: 115,948,784 M181L probably benign Het
Herc6 A T 6: 57,598,563 T190S probably benign Het
Hist1h3a A T 13: 23,762,100 F85Y probably damaging Het
Lama1 T G 17: 67,737,496 I130S Het
Letm2 T C 8: 25,581,713 D391G probably damaging Het
Map3k9 T C 12: 81,734,118 I423V probably damaging Het
Melk T A 4: 44,312,191 C168S possibly damaging Het
Muc4 CAC CACTAC 16: 32,754,076 probably benign Het
Naa16 A T 14: 79,359,475 N356K probably benign Het
Nup214 A G 2: 32,039,360 N1873S probably benign Het
Olfr1392 C T 11: 49,293,558 P79L probably damaging Het
Olfr890 T A 9: 38,143,685 C178* probably null Het
Pom121 A G 5: 135,381,178 F1042L unknown Het
Pxdn T C 12: 30,011,890 S1334P probably damaging Het
Ranbp1 C T 16: 18,245,306 E69K probably damaging Het
Rasl11a T C 5: 146,845,235 S7P probably damaging Het
Rev1 G A 1: 38,059,243 R740* probably null Het
Rnf157 C T 11: 116,349,420 V443M probably benign Het
Scn3a T A 2: 65,460,673 T1910S probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Siah2 T C 3: 58,676,082 N261S probably benign Het
Sumf2 T G 5: 129,860,162 W264G possibly damaging Het
Tal1 G T 4: 115,063,428 A100S probably benign Het
Tox2 G T 2: 163,204,630 R9L unknown Het
Traj46 A G 14: 54,172,338 E1G Het
Uhrf1bp1l A G 10: 89,812,092 T1339A probably benign Het
Unc80 A G 1: 66,641,629 D2128G possibly damaging Het
Usp21 A T 1: 171,284,717 F308I probably damaging Het
Vgf A T 5: 137,032,411 I476F probably damaging Het
Vmn1r142 T A 7: 22,163,323 H238L probably benign Het
Vps35 G A 8: 85,261,305 T739I possibly damaging Het
Wdr95 G T 5: 149,579,107 C279F probably damaging Het
Zbtb32 T C 7: 30,589,956 S94G unknown Het
Zdhhc13 T A 7: 48,802,999 I153N probably damaging Het
Other mutations in Fmn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Fmn1 APN 2 113444467 intron probably benign
IGL01520:Fmn1 APN 2 113444368 intron probably benign
IGL02039:Fmn1 APN 2 113365080 missense unknown
IGL02222:Fmn1 APN 2 113593109 missense probably damaging 1.00
IGL02238:Fmn1 APN 2 113582125 missense possibly damaging 0.90
IGL02373:Fmn1 APN 2 113364126 missense unknown
IGL02490:Fmn1 APN 2 113529472 splice site probably benign
IGL02506:Fmn1 APN 2 113525295 missense unknown
IGL02684:Fmn1 APN 2 113525277 missense unknown
IGL03008:Fmn1 APN 2 113365100 missense unknown
IGL03058:Fmn1 APN 2 113441814 intron probably benign
IGL03076:Fmn1 APN 2 113584092 missense probably damaging 0.99
FR4304:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4304:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4342:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525773 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525778 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525781 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525784 small insertion probably benign
R0349:Fmn1 UTSW 2 113365796 missense unknown
R0452:Fmn1 UTSW 2 113636779 missense possibly damaging 0.46
R0529:Fmn1 UTSW 2 113707853 splice site probably benign
R1215:Fmn1 UTSW 2 113693030 nonsense probably null
R1471:Fmn1 UTSW 2 113693094 missense possibly damaging 0.95
R1489:Fmn1 UTSW 2 113365212 missense unknown
R1491:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R1551:Fmn1 UTSW 2 113525862 missense possibly damaging 0.70
R1558:Fmn1 UTSW 2 113693118 missense possibly damaging 0.46
R1588:Fmn1 UTSW 2 113365698 missense unknown
R1602:Fmn1 UTSW 2 113525623 missense unknown
R1690:Fmn1 UTSW 2 113525482 missense unknown
R1772:Fmn1 UTSW 2 113365355 missense unknown
R1867:Fmn1 UTSW 2 113709438 missense probably damaging 1.00
R1923:Fmn1 UTSW 2 113429721 intron probably benign
R1941:Fmn1 UTSW 2 113365143 missense unknown
R2019:Fmn1 UTSW 2 113364480 missense unknown
R2140:Fmn1 UTSW 2 113595048 missense probably benign 0.45
R2164:Fmn1 UTSW 2 113365617 missense unknown
R2395:Fmn1 UTSW 2 113365181 missense unknown
R2999:Fmn1 UTSW 2 113365094 missense unknown
R3405:Fmn1 UTSW 2 113364348 missense unknown
R3407:Fmn1 UTSW 2 113365055 missense unknown
R3771:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3772:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3773:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3777:Fmn1 UTSW 2 113365122 missense unknown
R4166:Fmn1 UTSW 2 113636735 missense probably benign 0.33
R4477:Fmn1 UTSW 2 113444399 intron probably benign
R4614:Fmn1 UTSW 2 113365149 missense unknown
R4701:Fmn1 UTSW 2 113584071 missense possibly damaging 0.76
R4867:Fmn1 UTSW 2 113584120 critical splice donor site probably null
R5063:Fmn1 UTSW 2 113364921 missense unknown
R5224:Fmn1 UTSW 2 113365125 missense unknown
R5510:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R6083:Fmn1 UTSW 2 113364303 missense unknown
R6234:Fmn1 UTSW 2 113365655 missense unknown
R6266:Fmn1 UTSW 2 113596338 missense probably damaging 1.00
R6764:Fmn1 UTSW 2 113525215 missense unknown
R7054:Fmn1 UTSW 2 113365008 missense unknown
R7311:Fmn1 UTSW 2 113525680 missense unknown
R7439:Fmn1 UTSW 2 113441611 missense unknown
R7440:Fmn1 UTSW 2 113441611 missense unknown
R7441:Fmn1 UTSW 2 113441611 missense unknown
R7444:Fmn1 UTSW 2 113441611 missense unknown
R7461:Fmn1 UTSW 2 113364071 missense unknown
R7526:Fmn1 UTSW 2 113688134 missense probably damaging 0.99
R7540:Fmn1 UTSW 2 113529310 splice site probably null
R7576:Fmn1 UTSW 2 113365008 missense unknown
R7657:Fmn1 UTSW 2 113525193 missense unknown
R7669:Fmn1 UTSW 2 113365477 missense unknown
R7713:Fmn1 UTSW 2 113525814 missense unknown
R7841:Fmn1 UTSW 2 113529465 critical splice donor site probably null
R7953:Fmn1 UTSW 2 113596344 missense probably benign 0.03
R7959:Fmn1 UTSW 2 113365622 missense unknown
R8041:Fmn1 UTSW 2 113364594 missense unknown
R8152:Fmn1 UTSW 2 113365692 missense unknown
R8203:Fmn1 UTSW 2 113525275 missense unknown
R8318:Fmn1 UTSW 2 113365157 missense unknown
R8456:Fmn1 UTSW 2 113365040 missense unknown
R8698:Fmn1 UTSW 2 113429807 missense unknown
R8861:Fmn1 UTSW 2 113364804 missense unknown
RF003:Fmn1 UTSW 2 113525786 small insertion probably benign
Z1088:Fmn1 UTSW 2 113441925 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGTGTCTGAAAGCCATGGG -3'
(R):5'- CTCTATCACCTTGCGGAGAACC -3'

Sequencing Primer
(F):5'- TGGGAAACATGCAGGGGC -3'
(R):5'- CTTGCGGAGAACCTTGTTCACAG -3'
Posted On2020-09-02