Incidental Mutation 'R8399:Klra17'
ID647761
Institutional Source Beutler Lab
Gene Symbol Klra17
Ensembl Gene ENSMUSG00000014543
Gene Namekiller cell lectin-like receptor, subfamily A, member 17
SynonymsLy49q1, Ly-49Q, Ly49Q
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R8399 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location129831154-129876672 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 129874937 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014687] [ENSMUST00000122219]
Predicted Effect probably benign
Transcript: ENSMUST00000014687
SMART Domains Protein: ENSMUSP00000014687
Gene: ENSMUSG00000014543

DomainStartEndE-ValueType
low complexity region 52 69 N/A INTRINSIC
Blast:CLECT 73 126 2e-12 BLAST
CLECT 144 259 1.5e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122219
SMART Domains Protein: ENSMUSP00000114108
Gene: ENSMUSG00000014543

DomainStartEndE-ValueType
low complexity region 53 70 N/A INTRINSIC
Blast:CLECT 74 127 2e-12 BLAST
CLECT 145 260 1.5e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-in allele exhibit reduced plasmacytoid dendritic cell number and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,489,170 V3384D possibly damaging Het
Apba3 C A 10: 81,268,998 T35N probably benign Het
Bcl6 T C 16: 23,972,948 M219V probably benign Het
Bco2 T A 9: 50,541,118 T217S probably benign Het
C1s1 C T 6: 124,535,293 V277I probably benign Het
Ccdc162 T A 10: 41,539,521 R2149W probably damaging Het
Cers6 T C 2: 68,861,771 F46L probably benign Het
Chpf T C 1: 75,476,220 I359V probably benign Het
Chrnb4 A C 9: 55,043,823 L52R probably benign Het
Cox6a1 T C 5: 115,345,899 T95A probably damaging Het
Def8 T A 8: 123,455,499 Y197* probably null Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dnaaf3 C T 7: 4,523,937 probably null Het
Dnm1l T A 16: 16,321,672 H484L probably damaging Het
Eml1 G A 12: 108,538,131 S783N possibly damaging Het
Frmd4a T C 2: 4,572,433 S367P probably damaging Het
Hck A C 2: 153,138,317 K355N probably damaging Het
Hexim2 G T 11: 103,138,503 R127L probably damaging Het
Hivep2 T C 10: 14,132,434 L1592P possibly damaging Het
Htr1d G A 4: 136,443,375 G305E probably damaging Het
Ifi207 G A 1: 173,730,278 S298L unknown Het
Ighv1-11 A G 12: 114,612,427 V56A possibly damaging Het
Ighv7-1 G A 12: 113,896,912 T12I unknown Het
Kctd14 T C 7: 97,457,604 L22P probably damaging Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Maf T A 8: 115,706,512 I118F unknown Het
Mppe1 T C 18: 67,225,875 T341A probably benign Het
Mtmr2 T A 9: 13,792,067 V186E probably benign Het
Nedd9 G T 13: 41,318,474 Y176* probably null Het
Olfr1145 A C 2: 87,810,224 M135L probably damaging Het
Olfr1238 T C 2: 89,406,684 T132A probably benign Het
Omd A G 13: 49,589,869 I132V possibly damaging Het
Pcnx4 T A 12: 72,574,211 M935K probably benign Het
Pecr G A 1: 72,267,465 T219I probably benign Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Plcg2 T C 8: 117,596,362 Y719H probably damaging Het
Plk4 C T 3: 40,808,830 R479* probably null Het
Pms1 T A 1: 53,267,932 probably null Het
Raph1 C T 1: 60,489,318 S928N unknown Het
Rtp4 G T 16: 23,520,414 probably benign Het
Skor1 C T 9: 63,145,158 V510I possibly damaging Het
Smg1 T C 7: 118,190,571 T699A unknown Het
Tcp11l1 T C 2: 104,685,375 D381G probably benign Het
Tnik T A 3: 28,494,010 M56K unknown Het
Trappc9 G A 15: 73,052,282 R204C probably damaging Het
Trmt10b A T 4: 45,305,870 M184L possibly damaging Het
Vmn1r224 T A 17: 20,419,749 I196N probably damaging Het
Vmn1r49 A T 6: 90,072,707 C104* probably null Het
Vmn2r35 A C 7: 7,816,898 S124R probably benign Het
Wdr62 T C 7: 30,258,061 E547G probably damaging Het
Zfp68 A T 5: 138,607,820 D80E probably benign Het
Other mutations in Klra17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Klra17 APN 6 129831509 missense probably benign 0.12
IGL02084:Klra17 APN 6 129831593 missense probably damaging 1.00
IGL02995:Klra17 APN 6 129868684 critical splice donor site probably null
IGL03238:Klra17 APN 6 129868810 missense probably benign 0.43
R0118:Klra17 UTSW 6 129831589 missense probably benign 0.01
R0583:Klra17 UTSW 6 129868693 missense probably damaging 1.00
R1103:Klra17 UTSW 6 129868843 unclassified probably benign
R1378:Klra17 UTSW 6 129865684 missense probably damaging 0.96
R1513:Klra17 UTSW 6 129872314 missense possibly damaging 0.61
R1817:Klra17 UTSW 6 129868718 splice site probably null
R2262:Klra17 UTSW 6 129874794 critical splice donor site probably null
R2446:Klra17 UTSW 6 129831514 missense probably benign 0.02
R2484:Klra17 UTSW 6 129868757 missense probably damaging 1.00
R3410:Klra17 UTSW 6 129874846 missense probably damaging 0.99
R3411:Klra17 UTSW 6 129874846 missense probably damaging 0.99
R3739:Klra17 UTSW 6 129873365 missense probably benign 0.03
R4747:Klra17 UTSW 6 129872269 missense probably damaging 0.97
R4956:Klra17 UTSW 6 129873316 missense probably damaging 1.00
R5079:Klra17 UTSW 6 129872196 missense possibly damaging 0.72
R5310:Klra17 UTSW 6 129868708 missense probably damaging 1.00
R5366:Klra17 UTSW 6 129874895 missense possibly damaging 0.89
R5875:Klra17 UTSW 6 129874828 missense probably benign 0.01
R6043:Klra17 UTSW 6 129872187 critical splice donor site probably null
R6515:Klra17 UTSW 6 129831499 missense probably damaging 1.00
R6675:Klra17 UTSW 6 129872323 missense probably damaging 0.99
R7201:Klra17 UTSW 6 129873343 missense possibly damaging 0.62
R7296:Klra17 UTSW 6 129831592 missense possibly damaging 0.95
R8141:Klra17 UTSW 6 129872329 missense probably damaging 1.00
R8260:Klra17 UTSW 6 129831458 missense probably damaging 0.99
R8503:Klra17 UTSW 6 129868814 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTTCATAAACAAGCCCAGATGAAC -3'
(R):5'- CCAGTGGTTCCAATTTTACCTAAAC -3'

Sequencing Primer
(F):5'- TACCTTTGTGGCCAGCTT -3'
(R):5'- CCAGTCAGGGTCATTAAGTG -3'
Posted On2020-09-02