Incidental Mutation 'R8400:C4bp'
ID 647795
Institutional Source Beutler Lab
Gene Symbol C4bp
Ensembl Gene ENSMUSG00000026405
Gene Name complement component 4 binding protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8400 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 130634773-130661632 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 130636747 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 400 (C400F)
Ref Sequence ENSEMBL: ENSMUSP00000027657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027657]
AlphaFold P08607
Predicted Effect probably damaging
Transcript: ENSMUST00000027657
AA Change: C400F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027657
Gene: ENSMUSG00000026405
AA Change: C400F

DomainStartEndE-ValueType
CCP 58 115 3.45e-5 SMART
CCP 120 176 3.17e-13 SMART
CCP 181 240 4.59e-10 SMART
CCP 245 299 3.12e-12 SMART
CCP 303 355 7.28e-13 SMART
CCP 359 413 1.07e-10 SMART
PDB:4B0F|G 416 459 6e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000171642
SMART Domains Protein: ENSMUSP00000130533
Gene: ENSMUSG00000026405

DomainStartEndE-ValueType
CCP 16 75 4.59e-10 SMART
CCP 80 124 1.38e0 SMART
CCP 125 177 7.28e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,293,925 M1929I probably benign Het
Abca13 T C 11: 9,298,218 I2655T probably damaging Het
Acad10 A G 5: 121,626,205 V887A possibly damaging Het
Acot10 T C 15: 20,666,172 E161G possibly damaging Het
Astn1 C T 1: 158,657,100 P919L probably benign Het
Atp1a4 T A 1: 172,234,494 D688V probably damaging Het
Col6a6 A C 9: 105,774,796 D1005E probably damaging Het
Csnk1g3 C T 18: 53,953,288 R422C probably benign Het
Cutc T C 19: 43,753,205 S15P probably benign Het
Dgkb T C 12: 38,602,838 probably null Het
Disc1 T C 8: 125,232,993 V748A probably benign Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dmxl2 T C 9: 54,383,753 Y2471C probably benign Het
Fam185a T A 5: 21,438,816 N243K probably benign Het
Fchsd2 A T 7: 101,253,573 Q386L possibly damaging Het
Gm904 C A 13: 50,643,417 P49Q probably damaging Het
H2-Q10 C T 17: 35,470,477 R59C probably damaging Het
Ier5l A G 2: 30,473,093 Y307H possibly damaging Het
Kmt2e C A 5: 23,497,092 T906K probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Muc5ac C A 7: 141,810,476 T2508K probably damaging Het
Nlrp9a A T 7: 26,565,006 M784L probably benign Het
Nlrp9b T A 7: 20,024,012 C391* probably null Het
Nubp2 A C 17: 24,884,465 M146R probably damaging Het
Olfr1295 A T 2: 111,565,402 L14H probably damaging Het
Olfr1359 G A 13: 21,703,915 V305M probably benign Het
Olfr1419 T A 19: 11,871,214 M1L probably damaging Het
Olfr43 C T 11: 74,206,395 V274M possibly damaging Het
Olfr694 T A 7: 106,689,669 S21C probably benign Het
Olfr857 A T 9: 19,713,093 N89Y probably benign Het
Otud1 T C 2: 19,658,378 V106A possibly damaging Het
Pcdhac1 T A 18: 37,092,400 Y755* probably null Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,572 probably benign Het
Samhd1 T C 2: 157,099,433 E648G probably benign Het
Smarca5 T C 8: 80,709,127 T794A probably benign Het
Spc24 A T 9: 21,757,730 L87H probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Stra6l G A 4: 45,864,905 R77Q probably damaging Het
Tdrd1 G A 19: 56,848,649 V472M probably benign Het
Tsc2 A T 17: 24,604,987 I948K possibly damaging Het
Ttc39d T C 17: 80,216,005 V31A probably benign Het
Vmn1r158 A T 7: 22,789,880 C301* probably null Het
Vmn2r22 A T 6: 123,637,527 L368* probably null Het
Vmn2r79 A G 7: 87,002,100 T236A probably benign Het
Vwa1 T C 4: 155,772,768 H191R probably benign Het
Zdbf2 T A 1: 63,304,976 V838E possibly damaging Het
Other mutations in C4bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:C4bp APN 1 130639134 missense probably damaging 1.00
IGL01349:C4bp APN 1 130642928 intron probably benign
IGL01401:C4bp APN 1 130648064 missense possibly damaging 0.95
IGL02252:C4bp APN 1 130636787 missense probably damaging 1.00
IGL02903:C4bp APN 1 130655985 missense probably damaging 1.00
IGL02958:C4bp APN 1 130636795 missense probably damaging 1.00
IGL03061:C4bp APN 1 130636717 missense probably damaging 0.98
PIT4434001:C4bp UTSW 1 130657210 missense probably benign 0.14
R0989:C4bp UTSW 1 130643053 missense probably benign 0.02
R1728:C4bp UTSW 1 130642988 missense probably benign 0.04
R1729:C4bp UTSW 1 130642988 missense probably benign 0.04
R1730:C4bp UTSW 1 130642988 missense probably benign 0.04
R1739:C4bp UTSW 1 130642988 missense probably benign 0.04
R1762:C4bp UTSW 1 130642988 missense probably benign 0.04
R1783:C4bp UTSW 1 130642988 missense probably benign 0.04
R1784:C4bp UTSW 1 130642988 missense probably benign 0.04
R1785:C4bp UTSW 1 130642988 missense probably benign 0.04
R1942:C4bp UTSW 1 130656067 splice site probably benign
R2006:C4bp UTSW 1 130648032 nonsense probably null
R3877:C4bp UTSW 1 130648027 critical splice donor site probably null
R4446:C4bp UTSW 1 130642955 missense probably benign 0.06
R4551:C4bp UTSW 1 130636727 missense possibly damaging 0.46
R4552:C4bp UTSW 1 130636727 missense possibly damaging 0.46
R4727:C4bp UTSW 1 130639185 missense probably benign 0.19
R4761:C4bp UTSW 1 130653421 missense possibly damaging 0.83
R5620:C4bp UTSW 1 130653353 missense probably damaging 1.00
R6110:C4bp UTSW 1 130639072 nonsense probably null
R6189:C4bp UTSW 1 130636819 missense probably damaging 1.00
R6344:C4bp UTSW 1 130656015 missense probably benign 0.12
R6418:C4bp UTSW 1 130656013 missense probably damaging 1.00
R6895:C4bp UTSW 1 130636206 makesense probably null
R6964:C4bp UTSW 1 130657272 missense probably damaging 0.97
R8051:C4bp UTSW 1 130655968 missense probably damaging 1.00
R8156:C4bp UTSW 1 130639087 missense probably benign 0.06
R8297:C4bp UTSW 1 130636745 missense probably damaging 1.00
R9424:C4bp UTSW 1 130657175 missense probably damaging 1.00
R9428:C4bp UTSW 1 130653357 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GTTCTATGCCAACTCCCCAAATG -3'
(R):5'- GCATACACTGTCACAAATGTTCAAC -3'

Sequencing Primer
(F):5'- TATGCCAACTCCCCAAATGACATG -3'
(R):5'- AGCTACTTCAAGTTCAGTTCATTC -3'
Posted On 2020-09-02