Incidental Mutation 'R8400:H2-Q10'
ID647835
Institutional Source Beutler Lab
Gene Symbol H2-Q10
Ensembl Gene ENSMUSG00000067235
Gene Namehistocompatibility 2, Q region locus 10
SynonymsH-2Q10, Qa10, Q10
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8400 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location35470089-35474563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35470477 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 59 (R59C)
Ref Sequence ENSEMBL: ENSMUSP00000066419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068291] [ENSMUST00000174525]
Predicted Effect probably damaging
Transcript: ENSMUST00000068291
AA Change: R59C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066419
Gene: ENSMUSG00000067235
AA Change: R59C

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
Pfam:MHC_I 25 203 5.8e-98 PFAM
IGc1 222 293 8.23e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174525
AA Change: R59C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134163
Gene: ENSMUSG00000067235
AA Change: R59C

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
Pfam:MHC_I 25 203 3.3e-99 PFAM
IGc1 222 293 8.23e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Unlike other class I genes, this gene is expressed only in liver cells and its product is secreted into the serum. The amount of protein in serum varies among inbred strains with different H2 haplotypes and is completely absent in the H2f strain B10.M. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,293,925 M1929I probably benign Het
Abca13 T C 11: 9,298,218 I2655T probably damaging Het
Acad10 A G 5: 121,626,205 V887A possibly damaging Het
Acot10 T C 15: 20,666,172 E161G possibly damaging Het
Astn1 C T 1: 158,657,100 P919L probably benign Het
Atp1a4 T A 1: 172,234,494 D688V probably damaging Het
C4bp C A 1: 130,636,747 C400F probably damaging Het
Col6a6 A C 9: 105,774,796 D1005E probably damaging Het
Csnk1g3 C T 18: 53,953,288 R422C probably benign Het
Cutc T C 19: 43,753,205 S15P probably benign Het
Dgkb T C 12: 38,602,838 probably null Het
Disc1 T C 8: 125,232,993 V748A probably benign Het
Dmbt1 C G 7: 131,082,587 D778E unknown Het
Dmxl2 T C 9: 54,383,753 Y2471C probably benign Het
Fam185a T A 5: 21,438,816 N243K probably benign Het
Fchsd2 A T 7: 101,253,573 Q386L possibly damaging Het
Gm904 C A 13: 50,643,417 P49Q probably damaging Het
Ier5l A G 2: 30,473,093 Y307H possibly damaging Het
Kmt2e C A 5: 23,497,092 T906K probably benign Het
Kndc1 C T 7: 139,913,518 R467W probably damaging Het
Muc5ac C A 7: 141,810,476 T2508K probably damaging Het
Nlrp9a A T 7: 26,565,006 M784L probably benign Het
Nlrp9b T A 7: 20,024,012 C391* probably null Het
Nubp2 A C 17: 24,884,465 M146R probably damaging Het
Olfr1295 A T 2: 111,565,402 L14H probably damaging Het
Olfr1359 G A 13: 21,703,915 V305M probably benign Het
Olfr1419 T A 19: 11,871,214 M1L probably damaging Het
Olfr43 C T 11: 74,206,395 V274M possibly damaging Het
Olfr694 T A 7: 106,689,669 S21C probably benign Het
Olfr857 A T 9: 19,713,093 N89Y probably benign Het
Otud1 T C 2: 19,658,378 V106A possibly damaging Het
Pcdhac1 T A 18: 37,092,400 Y755* probably null Het
Pkd1l3 C T 8: 109,623,888 P455L possibly damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAGAGACCCTCAGGAACACTGCAAAGACCCTCGGGAGCACTGCAGAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,572 probably benign Het
Samhd1 T C 2: 157,099,433 E648G probably benign Het
Smarca5 T C 8: 80,709,127 T794A probably benign Het
Spc24 A T 9: 21,757,730 L87H probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Stra6l G A 4: 45,864,905 R77Q probably damaging Het
Tdrd1 G A 19: 56,848,649 V472M probably benign Het
Tsc2 A T 17: 24,604,987 I948K possibly damaging Het
Ttc39d T C 17: 80,216,005 V31A probably benign Het
Vmn1r158 A T 7: 22,789,880 C301* probably null Het
Vmn2r22 A T 6: 123,637,527 L368* probably null Het
Vmn2r79 A G 7: 87,002,100 T236A probably benign Het
Vwa1 T C 4: 155,772,768 H191R probably benign Het
Zdbf2 T A 1: 63,304,976 V838E possibly damaging Het
Other mutations in H2-Q10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01893:H2-Q10 APN 17 35473271 missense probably damaging 1.00
IGL02003:H2-Q10 APN 17 35470441 missense probably benign 0.01
IGL02308:H2-Q10 APN 17 35473566 makesense probably null
IGL02804:H2-Q10 APN 17 35473250 missense probably damaging 1.00
gomez UTSW 17 35474020 utr 3 prime probably benign
lurch UTSW 17 35471018 missense possibly damaging 0.92
R0278:H2-Q10 UTSW 17 35473307 missense possibly damaging 0.83
R1679:H2-Q10 UTSW 17 35473595 utr 3 prime probably benign
R1919:H2-Q10 UTSW 17 35470488 missense probably damaging 1.00
R3781:H2-Q10 UTSW 17 35471018 missense possibly damaging 0.92
R3782:H2-Q10 UTSW 17 35471018 missense possibly damaging 0.92
R4614:H2-Q10 UTSW 17 35474020 utr 3 prime probably benign
R4814:H2-Q10 UTSW 17 35473584 utr 3 prime probably benign
R4870:H2-Q10 UTSW 17 35470460 missense probably damaging 1.00
R6063:H2-Q10 UTSW 17 35470129 missense probably benign 0.13
R7448:H2-Q10 UTSW 17 35473560 missense not run
R7728:H2-Q10 UTSW 17 35470838 missense probably damaging 0.98
R8034:H2-Q10 UTSW 17 35470441 missense probably damaging 1.00
R8172:H2-Q10 UTSW 17 35471099 missense probably null 1.00
R8233:H2-Q10 UTSW 17 35471086 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AACAGCTTCTGCAGAGAGGG -3'
(R):5'- ACTGAAAGGGAATCCGGTCC -3'

Sequencing Primer
(F):5'- TCTTCACCCGAGCCCCG -3'
(R):5'- AATCCGGTCCTGGGTCAGTTC -3'
Posted On2020-09-02