Incidental Mutation 'R7982:Hsd17b11'
ID651257
Institutional Source Beutler Lab
Gene Symbol Hsd17b11
Ensembl Gene ENSMUSG00000029311
Gene Namehydroxysteroid (17-beta) dehydrogenase 11
SynonymsPan1b, Dhrs8, retSDR2, 17beta-HSD11
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7982 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location103989762-104021919 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104003224 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 215 (C215R)
Ref Sequence ENSEMBL: ENSMUSP00000031251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031251] [ENSMUST00000119025]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031251
AA Change: C215R

PolyPhen 2 Score 0.624 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031251
Gene: ENSMUSG00000029311
AA Change: C215R

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:KR 37 212 3e-9 PFAM
Pfam:adh_short 37 233 6.8e-52 PFAM
Pfam:adh_short_C2 43 227 9.7e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119025
AA Change: C215R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113455
Gene: ENSMUSG00000029311
AA Change: C215R

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:adh_short 37 204 6.1e-31 PFAM
Pfam:KR 38 212 5.2e-11 PFAM
Pfam:adh_short_C2 43 228 3.6e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Short-chain alcohol dehydrogenases, such as HSD17B11, metabolize secondary alcohols and ketones (Brereton et al., 2001 [PubMed 11165019]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Homozygous mutant mice exhibit an increased mean serum IgG2a response to ovalbumin challenge and an increased mean percentage of immature B cells in bone marrow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,173,640 S625P probably damaging Het
Actl6b A G 5: 137,563,162 N142S probably benign Het
Ank1 A T 8: 23,119,381 D1363V probably damaging Het
Aox4 A C 1: 58,257,241 L1032F possibly damaging Het
Bcl2l15 T C 3: 103,832,842 M4T probably damaging Het
Cand1 A T 10: 119,216,473 S242R probably damaging Het
Cant1 A T 11: 118,410,142 V229D probably benign Het
Ccdc117 A G 11: 5,531,460 S224P possibly damaging Het
Cdc42ep4 T C 11: 113,728,576 R330G possibly damaging Het
Cep164 T C 9: 45,778,864 E527G probably benign Het
Cfap58 A G 19: 47,974,567 D472G probably benign Het
Cln6 A C 9: 62,849,168 K198T possibly damaging Het
Col4a4 G A 1: 82,571,441 probably benign Het
Cyp1b1 T C 17: 79,710,490 Y412C probably damaging Het
Dhx30 A T 9: 110,085,456 L991Q probably damaging Het
Dst C T 1: 34,182,540 T2475I possibly damaging Het
Exoc8 A T 8: 124,896,410 V406E probably damaging Het
Fam214b T C 4: 43,034,483 T371A probably damaging Het
Grk6 T A 13: 55,451,706 C201S probably damaging Het
Helz T C 11: 107,626,630 V664A possibly damaging Het
Hspb11 T C 4: 107,275,283 V89A probably benign Het
Kbtbd12 T C 6: 88,618,634 I71M possibly damaging Het
Khdc1a A T 1: 21,350,906 H105L probably benign Het
Klf6 T A 13: 5,861,823 L62Q probably damaging Het
Mc1r A G 8: 123,408,140 R211G probably damaging Het
Nt5m T A 11: 59,848,331 W68R possibly damaging Het
Nufip1 T C 14: 76,126,239 V301A probably benign Het
Olfr104-ps T G 17: 37,362,611 F165V probably damaging Het
Olfr1535 T C 13: 21,555,966 N19D probably benign Het
Olfr209 A G 16: 59,361,564 I218T probably benign Het
Olfr455 T A 6: 42,538,291 T244S probably damaging Het
Olfr561 A T 7: 102,775,103 D193V probably damaging Het
Ostn T C 16: 27,321,439 probably null Het
Pcdhb6 C T 18: 37,334,220 R65* probably null Het
Pds5b T C 5: 150,769,941 I706T probably damaging Het
Pgm1 T G 5: 64,100,959 Y96D probably damaging Het
Pkd1l2 G A 8: 117,051,187 T875I possibly damaging Het
Poc1b A G 10: 99,164,902 S355G probably benign Het
Ppp6r1 A C 7: 4,643,158 D181E probably benign Het
Pstpip2 G A 18: 77,879,373 V325M probably benign Het
Rras2 A T 7: 114,058,951 V92D probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Ryr3 GTCTTCTTCTTCTTCTTC GTCTTCTTCTTCTTC 2: 112,669,249 probably benign Het
Stac2 T A 11: 98,042,553 M188L probably benign Het
Synrg G A 11: 84,019,818 D859N probably damaging Het
Tarbp1 A T 8: 126,444,301 S987T probably damaging Het
Tbx20 C A 9: 24,773,924 probably benign Het
Trim30d G T 7: 104,472,610 N309K possibly damaging Het
Ttc16 C T 2: 32,775,035 probably benign Het
Ttc34 T A 4: 154,861,418 I303N possibly damaging Het
Ubr4 T C 4: 139,428,208 probably null Het
Uros A T 7: 133,692,549 S168T unknown Het
Vmn2r6 C T 3: 64,559,820 G86D probably damaging Het
Ybx2 C T 11: 69,940,622 T295I possibly damaging Het
Zbed5 T A 5: 129,900,480 C146S possibly damaging Het
Zcchc2 G A 1: 106,031,171 C1124Y probably damaging Het
Zfp626 G A 7: 27,810,750 probably null Het
Other mutations in Hsd17b11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03237:Hsd17b11 APN 5 104003170 makesense probably null
R0681:Hsd17b11 UTSW 5 104003206 missense probably benign 0.09
R0905:Hsd17b11 UTSW 5 104009878 missense probably benign 0.05
R1611:Hsd17b11 UTSW 5 104009899 missense probably benign 0.26
R3951:Hsd17b11 UTSW 5 103992937 splice site probably benign
R4083:Hsd17b11 UTSW 5 103990568 missense possibly damaging 0.53
R4913:Hsd17b11 UTSW 5 103992882 missense probably benign 0.00
R5030:Hsd17b11 UTSW 5 104003292 missense probably damaging 0.99
R5034:Hsd17b11 UTSW 5 104018221 missense possibly damaging 0.72
R5965:Hsd17b11 UTSW 5 104021785 start gained probably benign
R7844:Hsd17b11 UTSW 5 104018266 missense probably damaging 1.00
R8016:Hsd17b11 UTSW 5 104021660 missense probably damaging 0.97
R8688:Hsd17b11 UTSW 5 104021718 missense probably benign 0.13
R8705:Hsd17b11 UTSW 5 103992837 missense probably benign
R8915:Hsd17b11 UTSW 5 103992936 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGAAAGCATCAGGTATCAGGC -3'
(R):5'- ACTTAGGAATGAAGCTCTGCCC -3'

Sequencing Primer
(F):5'- CATCAGGTATCAGGCGGTTCAG -3'
(R):5'- TACACCAGGCCTGTGATTCAG -3'
Posted On2020-09-15