Incidental Mutation 'R7982:Olfr561'
ID651266
Institutional Source Beutler Lab
Gene Symbol Olfr561
Ensembl Gene ENSMUSG00000073966
Gene Nameolfactory receptor 561
SynonymsMOR14-2, GA_x6K02T2PBJ9-5491151-5492095
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R7982 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location102771221-102776857 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102775103 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 193 (D193V)
Ref Sequence ENSEMBL: ENSMUSP00000150963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098217] [ENSMUST00000213432]
Predicted Effect probably damaging
Transcript: ENSMUST00000098217
AA Change: D193V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095819
Gene: ENSMUSG00000073966
AA Change: D193V

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 5.1e-122 PFAM
Pfam:7TM_GPCR_Srsx 37 259 9.6e-8 PFAM
Pfam:7tm_1 43 294 4.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213432
AA Change: D193V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,173,640 S625P probably damaging Het
Actl6b A G 5: 137,563,162 N142S probably benign Het
Ank1 A T 8: 23,119,381 D1363V probably damaging Het
Aox4 A C 1: 58,257,241 L1032F possibly damaging Het
Bcl2l15 T C 3: 103,832,842 M4T probably damaging Het
Cand1 A T 10: 119,216,473 S242R probably damaging Het
Cant1 A T 11: 118,410,142 V229D probably benign Het
Ccdc117 A G 11: 5,531,460 S224P possibly damaging Het
Cdc42ep4 T C 11: 113,728,576 R330G possibly damaging Het
Cep164 T C 9: 45,778,864 E527G probably benign Het
Cfap58 A G 19: 47,974,567 D472G probably benign Het
Cln6 A C 9: 62,849,168 K198T possibly damaging Het
Col4a4 G A 1: 82,571,441 probably benign Het
Cyp1b1 T C 17: 79,710,490 Y412C probably damaging Het
Dhx30 A T 9: 110,085,456 L991Q probably damaging Het
Dst C T 1: 34,182,540 T2475I possibly damaging Het
Exoc8 A T 8: 124,896,410 V406E probably damaging Het
Fam214b T C 4: 43,034,483 T371A probably damaging Het
Grk6 T A 13: 55,451,706 C201S probably damaging Het
Helz T C 11: 107,626,630 V664A possibly damaging Het
Hsd17b11 A G 5: 104,003,224 C215R possibly damaging Het
Hspb11 T C 4: 107,275,283 V89A probably benign Het
Kbtbd12 T C 6: 88,618,634 I71M possibly damaging Het
Khdc1a A T 1: 21,350,906 H105L probably benign Het
Klf6 T A 13: 5,861,823 L62Q probably damaging Het
Mc1r A G 8: 123,408,140 R211G probably damaging Het
Nt5m T A 11: 59,848,331 W68R possibly damaging Het
Nufip1 T C 14: 76,126,239 V301A probably benign Het
Olfr104-ps T G 17: 37,362,611 F165V probably damaging Het
Olfr1535 T C 13: 21,555,966 N19D probably benign Het
Olfr209 A G 16: 59,361,564 I218T probably benign Het
Olfr455 T A 6: 42,538,291 T244S probably damaging Het
Ostn T C 16: 27,321,439 probably null Het
Pcdhb6 C T 18: 37,334,220 R65* probably null Het
Pds5b T C 5: 150,769,941 I706T probably damaging Het
Pgm1 T G 5: 64,100,959 Y96D probably damaging Het
Pkd1l2 G A 8: 117,051,187 T875I possibly damaging Het
Poc1b A G 10: 99,164,902 S355G probably benign Het
Ppp6r1 A C 7: 4,643,158 D181E probably benign Het
Pstpip2 G A 18: 77,879,373 V325M probably benign Het
Rras2 A T 7: 114,058,951 V92D probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Ryr3 GTCTTCTTCTTCTTCTTC GTCTTCTTCTTCTTC 2: 112,669,249 probably benign Het
Stac2 T A 11: 98,042,553 M188L probably benign Het
Synrg G A 11: 84,019,818 D859N probably damaging Het
Tarbp1 A T 8: 126,444,301 S987T probably damaging Het
Tbx20 C A 9: 24,773,924 probably benign Het
Trim30d G T 7: 104,472,610 N309K possibly damaging Het
Ttc16 C T 2: 32,775,035 probably benign Het
Ttc34 T A 4: 154,861,418 I303N possibly damaging Het
Ubr4 T C 4: 139,428,208 probably null Het
Uros A T 7: 133,692,549 S168T unknown Het
Vmn2r6 C T 3: 64,559,820 G86D probably damaging Het
Ybx2 C T 11: 69,940,622 T295I possibly damaging Het
Zbed5 T A 5: 129,900,480 C146S possibly damaging Het
Zcchc2 G A 1: 106,031,171 C1124Y probably damaging Het
Zfp626 G A 7: 27,810,750 probably null Het
Other mutations in Olfr561
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Olfr561 APN 7 102774907 missense probably damaging 0.99
IGL02743:Olfr561 APN 7 102775298 missense probably damaging 0.99
IGL03001:Olfr561 APN 7 102775253 missense probably damaging 0.98
R0254:Olfr561 UTSW 7 102774869 nonsense probably null
R0356:Olfr561 UTSW 7 102775079 missense probably damaging 1.00
R0514:Olfr561 UTSW 7 102775332 missense probably benign 0.00
R0725:Olfr561 UTSW 7 102774532 missense probably benign
R0739:Olfr561 UTSW 7 102774665 missense probably damaging 1.00
R1900:Olfr561 UTSW 7 102775331 missense probably benign 0.19
R2080:Olfr561 UTSW 7 102775243 missense probably benign 0.02
R2212:Olfr561 UTSW 7 102774755 missense possibly damaging 0.77
R2379:Olfr561 UTSW 7 102774845 missense probably benign 0.33
R3412:Olfr561 UTSW 7 102774755 missense possibly damaging 0.77
R3834:Olfr561 UTSW 7 102775286 missense probably damaging 1.00
R4117:Olfr561 UTSW 7 102774477 splice site probably null
R4363:Olfr561 UTSW 7 102775256 missense probably benign 0.34
R4401:Olfr561 UTSW 7 102774799 nonsense probably null
R5176:Olfr561 UTSW 7 102775306 missense probably damaging 0.99
R5464:Olfr561 UTSW 7 102775433 missense probably benign 0.00
R5465:Olfr561 UTSW 7 102775433 missense probably benign 0.00
R5493:Olfr561 UTSW 7 102775108 missense probably benign 0.00
R5540:Olfr561 UTSW 7 102774929 missense probably benign 0.02
R5629:Olfr561 UTSW 7 102774640 missense possibly damaging 0.63
R6227:Olfr561 UTSW 7 102774676 missense probably damaging 0.98
R6367:Olfr561 UTSW 7 102774829 missense possibly damaging 0.92
R6497:Olfr561 UTSW 7 102775450 missense probably benign 0.00
R7219:Olfr561 UTSW 7 102781706 missense probably benign 0.00
R7243:Olfr561 UTSW 7 102781658 missense probably benign
R7289:Olfr561 UTSW 7 102775427 missense probably damaging 1.00
R7560:Olfr561 UTSW 7 102781682 missense probably damaging 1.00
R7731:Olfr561 UTSW 7 102774934 missense probably benign 0.05
R8025:Olfr561 UTSW 7 102775256 missense probably benign 0.34
R8222:Olfr561 UTSW 7 102774892 missense probably damaging 1.00
R8304:Olfr561 UTSW 7 102774710 missense possibly damaging 0.48
R8404:Olfr561 UTSW 7 102774927 nonsense probably null
R8540:Olfr561 UTSW 7 102775132 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CCCACTGAGGTATGCTATGATC -3'
(R):5'- GCACCAATGACAGGCTGATC -3'

Sequencing Primer
(F):5'- CACTGAGGTATGCTATGATCTTAACC -3'
(R):5'- CACCAATGACAGGCTGATCATAGG -3'
Posted On2020-09-15