Incidental Mutation 'R7982:Nufip1'
ID651292
Institutional Source Beutler Lab
Gene Symbol Nufip1
Ensembl Gene ENSMUSG00000022009
Gene Namenuclear fragile X mental retardation protein interacting protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7982 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location76110891-76137379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76126239 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 301 (V301A)
Ref Sequence ENSEMBL: ENSMUSP00000022586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022586]
Predicted Effect probably benign
Transcript: ENSMUST00000022586
AA Change: V301A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022586
Gene: ENSMUSG00000022009
AA Change: V301A

DomainStartEndE-ValueType
low complexity region 38 48 N/A INTRINSIC
low complexity region 80 99 N/A INTRINSIC
ZnF_C2H2 165 187 3.58e-2 SMART
ZnF_C2H2 188 212 5.4e1 SMART
low complexity region 291 304 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear RNA binding protein that contains a C2H2 zinc finger motif and a nuclear localization signal. This protein is associated with the nuclear matrix in perichromatin fibrils and, in neurons, localizes to the cytoplasm in association with endoplasmic reticulum ribosomes. This protein interacts with the fragile X mental retardation protein (FMRP), the tumor suppressor protein BRCA1, upregulates RNA polymerase II transcription, and is involved in box C/D snoRNP biogenesis. A pseudogene of this gene resides on chromosome 6q12. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,173,640 S625P probably damaging Het
Actl6b A G 5: 137,563,162 N142S probably benign Het
Ank1 A T 8: 23,119,381 D1363V probably damaging Het
Aox4 A C 1: 58,257,241 L1032F possibly damaging Het
Bcl2l15 T C 3: 103,832,842 M4T probably damaging Het
Cand1 A T 10: 119,216,473 S242R probably damaging Het
Cant1 A T 11: 118,410,142 V229D probably benign Het
Ccdc117 A G 11: 5,531,460 S224P possibly damaging Het
Cdc42ep4 T C 11: 113,728,576 R330G possibly damaging Het
Cep164 T C 9: 45,778,864 E527G probably benign Het
Cfap58 A G 19: 47,974,567 D472G probably benign Het
Cln6 A C 9: 62,849,168 K198T possibly damaging Het
Col4a4 G A 1: 82,571,441 probably benign Het
Cyp1b1 T C 17: 79,710,490 Y412C probably damaging Het
Dhx30 A T 9: 110,085,456 L991Q probably damaging Het
Dst C T 1: 34,182,540 T2475I possibly damaging Het
Exoc8 A T 8: 124,896,410 V406E probably damaging Het
Fam214b T C 4: 43,034,483 T371A probably damaging Het
Grk6 T A 13: 55,451,706 C201S probably damaging Het
Helz T C 11: 107,626,630 V664A possibly damaging Het
Hsd17b11 A G 5: 104,003,224 C215R possibly damaging Het
Hspb11 T C 4: 107,275,283 V89A probably benign Het
Kbtbd12 T C 6: 88,618,634 I71M possibly damaging Het
Khdc1a A T 1: 21,350,906 H105L probably benign Het
Klf6 T A 13: 5,861,823 L62Q probably damaging Het
Mc1r A G 8: 123,408,140 R211G probably damaging Het
Nt5m T A 11: 59,848,331 W68R possibly damaging Het
Olfr104-ps T G 17: 37,362,611 F165V probably damaging Het
Olfr1535 T C 13: 21,555,966 N19D probably benign Het
Olfr209 A G 16: 59,361,564 I218T probably benign Het
Olfr455 T A 6: 42,538,291 T244S probably damaging Het
Olfr561 A T 7: 102,775,103 D193V probably damaging Het
Ostn T C 16: 27,321,439 probably null Het
Pcdhb6 C T 18: 37,334,220 R65* probably null Het
Pds5b T C 5: 150,769,941 I706T probably damaging Het
Pgm1 T G 5: 64,100,959 Y96D probably damaging Het
Pkd1l2 G A 8: 117,051,187 T875I possibly damaging Het
Poc1b A G 10: 99,164,902 S355G probably benign Het
Ppp6r1 A C 7: 4,643,158 D181E probably benign Het
Pstpip2 G A 18: 77,879,373 V325M probably benign Het
Rras2 A T 7: 114,058,951 V92D probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Ryr3 GTCTTCTTCTTCTTCTTC GTCTTCTTCTTCTTC 2: 112,669,249 probably benign Het
Stac2 T A 11: 98,042,553 M188L probably benign Het
Synrg G A 11: 84,019,818 D859N probably damaging Het
Tarbp1 A T 8: 126,444,301 S987T probably damaging Het
Tbx20 C A 9: 24,773,924 probably benign Het
Trim30d G T 7: 104,472,610 N309K possibly damaging Het
Ttc16 C T 2: 32,775,035 probably benign Het
Ttc34 T A 4: 154,861,418 I303N possibly damaging Het
Ubr4 T C 4: 139,428,208 probably null Het
Uros A T 7: 133,692,549 S168T unknown Het
Vmn2r6 C T 3: 64,559,820 G86D probably damaging Het
Ybx2 C T 11: 69,940,622 T295I possibly damaging Het
Zbed5 T A 5: 129,900,480 C146S possibly damaging Het
Zcchc2 G A 1: 106,031,171 C1124Y probably damaging Het
Zfp626 G A 7: 27,810,750 probably null Het
Other mutations in Nufip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03035:Nufip1 APN 14 76115818 missense probably damaging 1.00
R0748:Nufip1 UTSW 14 76111068 missense probably damaging 1.00
R1576:Nufip1 UTSW 14 76134870 missense probably benign 0.00
R1641:Nufip1 UTSW 14 76126252 missense possibly damaging 0.55
R1992:Nufip1 UTSW 14 76134847 missense probably damaging 1.00
R5093:Nufip1 UTSW 14 76110973 missense probably benign 0.12
R5191:Nufip1 UTSW 14 76111989 missense probably damaging 1.00
R5212:Nufip1 UTSW 14 76133098 missense possibly damaging 0.72
R5282:Nufip1 UTSW 14 76114275 critical splice donor site probably null
R5635:Nufip1 UTSW 14 76126146 missense probably damaging 1.00
R5916:Nufip1 UTSW 14 76134900 makesense probably null
R5990:Nufip1 UTSW 14 76114188 missense probably damaging 0.99
R6328:Nufip1 UTSW 14 76111054 missense possibly damaging 0.62
R6333:Nufip1 UTSW 14 76111985 missense probably damaging 1.00
R6697:Nufip1 UTSW 14 76133073 missense probably benign 0.09
R7129:Nufip1 UTSW 14 76134885 missense possibly damaging 0.82
R7585:Nufip1 UTSW 14 76110987 missense probably benign 0.02
R7670:Nufip1 UTSW 14 76111974 frame shift probably null
R7848:Nufip1 UTSW 14 76114221 missense probably damaging 1.00
R7912:Nufip1 UTSW 14 76115002 missense possibly damaging 0.90
R8202:Nufip1 UTSW 14 76111164 missense probably benign 0.03
X0067:Nufip1 UTSW 14 76130861 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAACCTTTAAGTCTGGGCC -3'
(R):5'- AGCACGGCATACCTTACTCAG -3'

Sequencing Primer
(F):5'- AAGTCTGGGCCTTTCTTTAATTTG -3'
(R):5'- CTTACTCAGTAACTATTAGCTGTGC -3'
Posted On2020-09-15