Incidental Mutation 'R7982:Abcb6'
ID651245
Institutional Source Beutler Lab
Gene Symbol Abcb6
Ensembl Gene ENSMUSG00000026198
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 6
Synonyms1200005B17Rik
MMRRC Submission
Accession Numbers

Genbank: NM_023732.2; Ensembl: ENSMUST00000027396, ENSMUST00000161215

Is this an essential gene? Possibly non essential (E-score: 0.286) question?
Stock #R7982 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location75171717-75180392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75173640 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 625 (S625P)
Ref Sequence ENSEMBL: ENSMUSP00000027396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027394] [ENSMUST00000027396] [ENSMUST00000160439] [ENSMUST00000161215] [ENSMUST00000162768]
Predicted Effect probably benign
Transcript: ENSMUST00000027394
SMART Domains Protein: ENSMUSP00000027394
Gene: ENSMUSG00000026197

DomainStartEndE-ValueType
ZnF_AN1 10 49 2e-4 SMART
low complexity region 54 66 N/A INTRINSIC
ZnF_AN1 100 139 6.69e-3 SMART
low complexity region 155 179 N/A INTRINSIC
UIM 197 216 1.3e-2 SMART
UIM 221 240 1.26e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000027396
AA Change: S625P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027396
Gene: ENSMUSG00000026198
AA Change: S625P

DomainStartEndE-ValueType
Pfam:MTABC_N 6 255 7.8e-80 PFAM
Pfam:ABC_membrane 265 544 3.7e-34 PFAM
AAA 615 816 1.29e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160439
SMART Domains Protein: ENSMUSP00000125086
Gene: ENSMUSG00000026197

DomainStartEndE-ValueType
ZnF_AN1 10 49 2e-4 SMART
low complexity region 54 66 N/A INTRINSIC
ZnF_AN1 100 139 6.69e-3 SMART
low complexity region 155 179 N/A INTRINSIC
UIM 197 216 1.3e-2 SMART
UIM 221 240 1.26e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161215
SMART Domains Protein: ENSMUSP00000124630
Gene: ENSMUSG00000026198

DomainStartEndE-ValueType
SCOP:d1jj7a_ 5 78 8e-23 SMART
Blast:AAA 23 71 9e-25 BLAST
PDB:3NHB|A 23 94 3e-36 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000162768
SMART Domains Protein: ENSMUSP00000124552
Gene: ENSMUSG00000026197

DomainStartEndE-ValueType
ZnF_AN1 10 49 2e-4 SMART
low complexity region 54 66 N/A INTRINSIC
ZnF_AN1 100 139 6.69e-3 SMART
low complexity region 155 179 N/A INTRINSIC
UIM 197 216 1.3e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186227
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This half-transporter likely plays a role in mitochondrial function. Localized to 2q26, this gene is considered a candidate gene for lethal neonatal metabolic syndrome, a disorder of mitochondrial function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display partial lethality, impaired stress erythropoiesis, and absence of ATP-dependent transport of Coproporphyrin III in mitochondria. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,563,162 N142S probably benign Het
Ank1 A T 8: 23,119,381 D1363V probably damaging Het
Aox4 A C 1: 58,257,241 L1032F possibly damaging Het
Bcl2l15 T C 3: 103,832,842 M4T probably damaging Het
Cand1 A T 10: 119,216,473 S242R probably damaging Het
Cant1 A T 11: 118,410,142 V229D probably benign Het
Ccdc117 A G 11: 5,531,460 S224P possibly damaging Het
Cdc42ep4 T C 11: 113,728,576 R330G possibly damaging Het
Cep164 T C 9: 45,778,864 E527G probably benign Het
Cfap58 A G 19: 47,974,567 D472G probably benign Het
Cln6 A C 9: 62,849,168 K198T possibly damaging Het
Col4a4 G A 1: 82,571,441 probably benign Het
Cyp1b1 T C 17: 79,710,490 Y412C probably damaging Het
Dhx30 A T 9: 110,085,456 L991Q probably damaging Het
Dst C T 1: 34,182,540 T2475I possibly damaging Het
Exoc8 A T 8: 124,896,410 V406E probably damaging Het
Fam214b T C 4: 43,034,483 T371A probably damaging Het
Grk6 T A 13: 55,451,706 C201S probably damaging Het
Helz T C 11: 107,626,630 V664A possibly damaging Het
Hsd17b11 A G 5: 104,003,224 C215R possibly damaging Het
Hspb11 T C 4: 107,275,283 V89A probably benign Het
Kbtbd12 T C 6: 88,618,634 I71M possibly damaging Het
Khdc1a A T 1: 21,350,906 H105L probably benign Het
Klf6 T A 13: 5,861,823 L62Q probably damaging Het
Mc1r A G 8: 123,408,140 R211G probably damaging Het
Nt5m T A 11: 59,848,331 W68R possibly damaging Het
Nufip1 T C 14: 76,126,239 V301A probably benign Het
Olfr104-ps T G 17: 37,362,611 F165V probably damaging Het
Olfr1535 T C 13: 21,555,966 N19D probably benign Het
Olfr209 A G 16: 59,361,564 I218T probably benign Het
Olfr455 T A 6: 42,538,291 T244S probably damaging Het
Olfr561 A T 7: 102,775,103 D193V probably damaging Het
Ostn T C 16: 27,321,439 probably null Het
Pcdhb6 C T 18: 37,334,220 R65* probably null Het
Pds5b T C 5: 150,769,941 I706T probably damaging Het
Pgm1 T G 5: 64,100,959 Y96D probably damaging Het
Pkd1l2 G A 8: 117,051,187 T875I possibly damaging Het
Poc1b A G 10: 99,164,902 S355G probably benign Het
Ppp6r1 A C 7: 4,643,158 D181E probably benign Het
Pstpip2 G A 18: 77,879,373 V325M probably benign Het
Rras2 A T 7: 114,058,951 V92D probably damaging Het
Rsf1 CGGC CGGCGGCGGGGGC 7: 97,579,932 probably benign Het
Ryr3 GTCTTCTTCTTCTTCTTC GTCTTCTTCTTCTTC 2: 112,669,249 probably benign Het
Stac2 T A 11: 98,042,553 M188L probably benign Het
Synrg G A 11: 84,019,818 D859N probably damaging Het
Tarbp1 A T 8: 126,444,301 S987T probably damaging Het
Tbx20 C A 9: 24,773,924 probably benign Het
Trim30d G T 7: 104,472,610 N309K possibly damaging Het
Ttc16 C T 2: 32,775,035 probably benign Het
Ttc34 T A 4: 154,861,418 I303N possibly damaging Het
Ubr4 T C 4: 139,428,208 probably null Het
Uros A T 7: 133,692,549 S168T unknown Het
Vmn2r6 C T 3: 64,559,820 G86D probably damaging Het
Ybx2 C T 11: 69,940,622 T295I possibly damaging Het
Zbed5 T A 5: 129,900,480 C146S possibly damaging Het
Zcchc2 G A 1: 106,031,171 C1124Y probably damaging Het
Zfp626 G A 7: 27,810,750 probably null Het
Other mutations in Abcb6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02836:Abcb6 APN 1 75178002 missense probably damaging 0.96
1mM(1):Abcb6 UTSW 1 75172111 unclassified probably benign
R0035:Abcb6 UTSW 1 75175007 missense possibly damaging 0.74
R0699:Abcb6 UTSW 1 75171909 missense probably damaging 0.98
R1470:Abcb6 UTSW 1 75172679 unclassified probably benign
R1595:Abcb6 UTSW 1 75177300 splice site probably null
R1912:Abcb6 UTSW 1 75179955 missense probably benign
R2078:Abcb6 UTSW 1 75172136 missense probably damaging 1.00
R3105:Abcb6 UTSW 1 75175043 unclassified probably benign
R4015:Abcb6 UTSW 1 75174491 splice site probably null
R4604:Abcb6 UTSW 1 75179877 missense probably benign
R4633:Abcb6 UTSW 1 75177782 unclassified probably benign
R4748:Abcb6 UTSW 1 75177358 missense probably damaging 1.00
R5530:Abcb6 UTSW 1 75177912 unclassified probably benign
R5654:Abcb6 UTSW 1 75174835 splice site probably null
R5841:Abcb6 UTSW 1 75174350 missense possibly damaging 0.88
R6275:Abcb6 UTSW 1 75172551 splice site probably null
R6527:Abcb6 UTSW 1 75177488 critical splice acceptor site probably null
R7188:Abcb6 UTSW 1 75174137 critical splice donor site probably null
R7278:Abcb6 UTSW 1 75174373 missense possibly damaging 0.88
R7451:Abcb6 UTSW 1 75172153 missense probably damaging 1.00
R7481:Abcb6 UTSW 1 75173604 missense probably damaging 1.00
R7608:Abcb6 UTSW 1 75177703 missense probably benign 0.01
R7640:Abcb6 UTSW 1 75174845 splice site probably null
R7883:Abcb6 UTSW 1 75178016 missense possibly damaging 0.81
R8057:Abcb6 UTSW 1 75174358 missense probably damaging 0.99
R8058:Abcb6 UTSW 1 75180009 missense possibly damaging 0.79
R8155:Abcb6 UTSW 1 75174769 missense probably damaging 0.99
R8309:Abcb6 UTSW 1 75172944 missense probably benign 0.43
X0009:Abcb6 UTSW 1 75174553 missense probably benign 0.35
Z1177:Abcb6 UTSW 1 75176125 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCAAGGCTGGTGTCTCAG -3'
(R):5'- AGAGAAATACTAGCTACGTGGCC -3'

Sequencing Primer
(F):5'- CTGGTGTCTCAGGGGTGCC -3'
(R):5'- AGCTACGTGGCCCACATTC -3'
Posted On2020-09-15