Incidental Mutation 'R8403:Nr4a3'
ID652262
Institutional Source Beutler Lab
Gene Symbol Nr4a3
Ensembl Gene ENSMUSG00000028341
Gene Namenuclear receptor subfamily 4, group A, member 3
SynonymsNor1, TEC, MINOR, NOR-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8403 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location48045153-48086447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48051348 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 34 (D34G)
Ref Sequence ENSEMBL: ENSMUSP00000030025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030025]
Predicted Effect probably damaging
Transcript: ENSMUST00000030025
AA Change: D34G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030025
Gene: ENSMUSG00000028341
AA Change: D34G

DomainStartEndE-ValueType
Blast:HOLI 1 43 4e-18 BLAST
low complexity region 99 115 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 196 210 N/A INTRINSIC
low complexity region 218 239 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
ZnF_C4 290 361 4.57e-39 SMART
low complexity region 376 396 N/A INTRINSIC
HOLI 440 595 2.46e-21 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000121455
Gene: ENSMUSG00000028341
AA Change: D63G

DomainStartEndE-ValueType
Blast:HOLI 30 73 8e-19 BLAST
low complexity region 129 145 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
low complexity region 248 269 N/A INTRINSIC
low complexity region 299 318 N/A INTRINSIC
ZnF_C4 320 391 4.57e-39 SMART
low complexity region 406 426 N/A INTRINSIC
HOLI 470 625 2.46e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: This gene encodes a member of the NR4A subfamily of nuclear hormone receptors that bind to DNA and modulate gene expression. The encoded protein has been implicated in T and B lymphocyte apoptosis, and immune cell proliferation. Mice lacking the encoded protein exhibit partial bidirectional circling behavior and inner ear dysfunction. Disruption of this gene in mice also results in defective hippocampal axonal growth and postnatal neuronal cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in the semicircular canals of the inner ear and bidirectional circling behavior. Mice homozygous for another null allele display embryonic lethality with impaired cell migration during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adora2b T A 11: 62,249,315 C72S probably damaging Het
Atcay T C 10: 81,212,948 Y183C probably damaging Het
Atp1a1 A T 3: 101,586,904 I460N probably damaging Het
Celf4 T C 18: 25,504,270 S223G possibly damaging Het
Ces2c T A 8: 104,848,082 V57D probably damaging Het
Ces2f T C 8: 104,948,176 V70A possibly damaging Het
Cntnap1 C T 11: 101,177,590 P114S probably damaging Het
Cpsf1 A G 15: 76,600,283 F666S probably damaging Het
Cuzd1 T A 7: 131,311,568 D440V probably damaging Het
Dhx57 T C 17: 80,278,289 E107G probably damaging Het
Dopey1 G T 9: 86,500,872 R286L probably damaging Het
Fam135a G A 1: 24,028,827 T987I probably benign Het
Fastkd1 G T 2: 69,687,081 Y818* probably null Het
Fer1l4 A C 2: 156,052,243 F47V possibly damaging Het
Fryl A G 5: 73,118,447 *125R probably null Het
Gm5096 C T 18: 87,757,451 S366F probably damaging Het
Herc6 A G 6: 57,583,206 D77G probably benign Het
Hmox1 T C 8: 75,097,331 L209P probably damaging Het
Kcns3 A T 12: 11,091,653 D348E probably benign Het
Lama1 T A 17: 67,745,923 I417N Het
Lmo7 T C 14: 101,902,364 S1028P probably benign Het
Lrrc37a C G 11: 103,501,585 E1005Q probably benign Het
Mis18bp1 A T 12: 65,154,811 I372K possibly damaging Het
Olfr1218 A T 2: 89,054,604 V274D probably benign Het
Parp12 T C 6: 39,091,345 D496G probably benign Het
Rom1 A G 19: 8,927,880 V282A probably benign Het
Rp1l1 G A 14: 64,028,809 V615I probably benign Het
Rpgrip1 A G 14: 52,152,201 probably null Het
Ryr2 A G 13: 11,684,478 I2959T possibly damaging Het
Sema4a T G 3: 88,452,034 K117Q probably damaging Het
Slc22a29 A G 19: 8,161,640 M486T possibly damaging Het
Sntb2 T A 8: 107,001,534 C371* probably null Het
Spata31d1c A G 13: 65,036,230 T529A probably benign Het
Tchp G T 5: 114,708,766 R38L possibly damaging Het
Tnpo2 T C 8: 85,047,297 V320A probably benign Het
Trim50 A T 5: 135,363,792 D187V probably damaging Het
Ttl A G 2: 129,081,243 E168G possibly damaging Het
Tuba1c T A 15: 99,034,104 I5N probably damaging Het
Tyr C T 7: 87,437,967 G446R probably damaging Het
Vps35 C T 8: 85,274,858 V444I probably benign Het
Vstm2b T C 7: 40,902,475 S76P probably damaging Het
Other mutations in Nr4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Nr4a3 APN 4 48051586 missense possibly damaging 0.48
IGL01407:Nr4a3 APN 4 48083201 missense probably benign 0.00
IGL01454:Nr4a3 APN 4 48067803 missense probably damaging 1.00
IGL01472:Nr4a3 APN 4 48071133 missense probably damaging 1.00
IGL02622:Nr4a3 APN 4 48051649 missense probably benign 0.06
IGL03401:Nr4a3 APN 4 48070987 splice site probably null
bulbous UTSW 4 48083255 missense probably damaging 0.98
cronus UTSW 4 48056539 missense probably damaging 1.00
I1329:Nr4a3 UTSW 4 48051585 missense probably benign 0.12
R0486:Nr4a3 UTSW 4 48056525 splice site probably benign
R0610:Nr4a3 UTSW 4 48051903 missense probably benign 0.10
R1170:Nr4a3 UTSW 4 48051564 missense probably damaging 0.98
R1170:Nr4a3 UTSW 4 48083324 missense probably benign 0.01
R1440:Nr4a3 UTSW 4 48051777 missense probably benign
R1977:Nr4a3 UTSW 4 48056539 missense probably damaging 1.00
R2016:Nr4a3 UTSW 4 48083252 missense probably damaging 1.00
R2046:Nr4a3 UTSW 4 48067807 missense possibly damaging 0.82
R2055:Nr4a3 UTSW 4 48067771 missense possibly damaging 0.86
R3707:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R3708:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R4246:Nr4a3 UTSW 4 48083125 missense possibly damaging 0.86
R4657:Nr4a3 UTSW 4 48051522 missense probably damaging 1.00
R4870:Nr4a3 UTSW 4 48051651 missense possibly damaging 0.73
R5434:Nr4a3 UTSW 4 48067861 missense probably damaging 1.00
R5539:Nr4a3 UTSW 4 48056525 splice site probably null
R5663:Nr4a3 UTSW 4 48055931 missense probably damaging 1.00
R6513:Nr4a3 UTSW 4 48083255 missense probably damaging 0.98
R6664:Nr4a3 UTSW 4 48056006 missense probably damaging 1.00
R6921:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R6940:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R7076:Nr4a3 UTSW 4 48055957 missense probably damaging 1.00
R7322:Nr4a3 UTSW 4 48083238 missense probably benign 0.00
R7347:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7348:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7349:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7361:Nr4a3 UTSW 4 48083203 missense probably benign 0.00
R7365:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7366:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7418:Nr4a3 UTSW 4 48051476 missense probably damaging 1.00
R7659:Nr4a3 UTSW 4 48051269 missense probably damaging 1.00
R7895:Nr4a3 UTSW 4 48051390 missense probably benign
R7986:Nr4a3 UTSW 4 48055954 missense probably damaging 1.00
R8022:Nr4a3 UTSW 4 48051510 missense probably damaging 1.00
R8226:Nr4a3 UTSW 4 48056588 missense probably damaging 1.00
R8328:Nr4a3 UTSW 4 48051323 missense probably damaging 1.00
R8349:Nr4a3 UTSW 4 48052170 missense probably benign 0.40
R8449:Nr4a3 UTSW 4 48052170 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CATTCAGTCTTTGCCAGCAG -3'
(R):5'- TCTTCCATCTTGATCAAAGGCC -3'

Sequencing Primer
(F):5'- GTTTCCTGATTCAAGAGCAGTGGAAC -3'
(R):5'- CATCTTGATCAAAGGCCGAGGC -3'
Posted On2020-10-20