Mutagenetix > Incidental Mutations

Incidental Mutation 'R1977:Nr4a3'

221817

Institutional Source

Beutler Lab

Gene Symbol

Nr4a3

Ensembl Gene

ENSMUSG00000028341

Gene Name

nuclear receptor subfamily 4, group A, member 3

Synonyms

Nor1, TEC, MINOR, NOR-1

MMRRC Submission

039990-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1977 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

48045153-48086447 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 48056539 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 364 (R364S)

Ref Sequence

ENSEMBL: ENSMUSP00000030025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030025]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030025
AA Change: R364S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030025
Gene: ENSMUSG00000028341
AA Change: R364S

Domain	Start	End	E-Value	Type
Blast:HOLI	1	43	4e-18	BLAST
low complexity region	99	115	N/A	INTRINSIC
low complexity region	139	151	N/A	INTRINSIC
low complexity region	196	210	N/A	INTRINSIC
low complexity region	218	239	N/A	INTRINSIC
low complexity region	269	288	N/A	INTRINSIC
ZnF_C4	290	361	4.57e-39	SMART
low complexity region	376	396	N/A	INTRINSIC
HOLI	440	595	2.46e-21	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133539

Predicted Effect

unknown
Transcript: ENSMUST00000153369
AA Change: R393S

SMART Domains

Protein: ENSMUSP00000121455
Gene: ENSMUSG00000028341
AA Change: R393S

Domain	Start	End	E-Value	Type
Blast:HOLI	30	73	8e-19	BLAST
low complexity region	129	145	N/A	INTRINSIC
low complexity region	169	181	N/A	INTRINSIC
low complexity region	226	240	N/A	INTRINSIC
low complexity region	248	269	N/A	INTRINSIC
low complexity region	299	318	N/A	INTRINSIC
ZnF_C4	320	391	4.57e-39	SMART
low complexity region	406	426	N/A	INTRINSIC
HOLI	470	625	2.46e-21	SMART

Meta Mutation Damage Score

0.8179

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

99% (66/67)

MGI Phenotype

FUNCTION: This gene encodes a member of the NR4A subfamily of nuclear hormone receptors that bind to DNA and modulate gene expression. The encoded protein has been implicated in T and B lymphocyte apoptosis, and immune cell proliferation. Mice lacking the encoded protein exhibit partial bidirectional circling behavior and inner ear dysfunction. Disruption of this gene in mice also results in defective hippocampal axonal growth and postnatal neuronal cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in the semicircular canals of the inner ear and bidirectional circling behavior. Mice homozygous for another null allele display embryonic lethality with impaired cell migration during gastrulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsf3	G	T	8: 122,781,533	C256F	probably damaging	Het
Adgra2	T	A	8: 27,115,761	V647D	possibly damaging	Het
AI593442	A	T	9: 52,678,192	S28R	probably damaging	Het
Akr1c21	G	C	13: 4,574,212	G22R	probably damaging	Het
Ampd3	T	C	7: 110,803,162	W458R	probably damaging	Het
Arhgap23	G	T	11: 97,451,447	R185L	possibly damaging	Het
Arhgap45	A	T	10: 80,020,818	I67F	probably damaging	Het
Asah1	A	G	8: 41,343,517		probably null	Het
Atl2	A	G	17: 79,852,590	Y56H	probably damaging	Het
Carf	A	T	1: 60,146,136	I447F	probably damaging	Het
Crmp1	A	G	5: 37,276,283	N162S	probably damaging	Het
Cyp2a5	A	G	7: 26,835,922	E103G	probably benign	Het
Cyp2c40	T	C	19: 39,778,041	D370G	probably damaging	Het
Dhrs2	T	A	14: 55,234,655	M1K	probably null	Het
Dnah17	T	C	11: 118,112,591	E810G	possibly damaging	Het
E2f5	T	A	3: 14,587,356	I84N	probably damaging	Het
Eif2ak4	A	T	2: 118,461,757	K1185*	probably null	Het
Eif4ebp1	T	A	8: 27,275,101	M115K	probably damaging	Het
Evi5	A	T	5: 107,799,139	L505*	probably null	Het
Fbxw25	T	A	9: 109,652,856	Y254F	possibly damaging	Het
Gm7964	T	A	7: 83,757,352	F439Y	possibly damaging	Het
Gps1	A	G	11: 120,785,826	T124A	probably damaging	Het
Hopx	T	C	5: 77,117,616		probably benign	Het
Hoxd3	A	G	2: 74,744,276	S89G	possibly damaging	Het
Hrc	A	T	7: 45,336,214	D263V	probably damaging	Het
Hs6st3	T	C	14: 119,138,476	I21T	probably benign	Het
Izumo4	A	G	10: 80,703,121	Y106C	probably damaging	Het
Lama2	A	T	10: 26,990,800		probably null	Het
Lcorl	A	C	5: 45,775,420	S123R	probably null	Het
Lgr4	A	T	2: 110,011,928	I729F	probably damaging	Het
Lonp1	T	C	17: 56,615,068	T771A	possibly damaging	Het
Matn3	T	A	12: 8,961,110		probably benign	Het
Mdc1	T	A	17: 35,850,930	S912T	probably benign	Het
Mgam	G	A	6: 40,664,880	V556I	probably benign	Het
Myom2	A	T	8: 15,085,263	I489F	possibly damaging	Het
Nfatc2	G	A	2: 168,504,459	T905I	possibly damaging	Het
Nme6	G	A	9: 109,835,341	R6Q	probably damaging	Het
Nr1h5	A	G	3: 102,947,817	S323P	probably damaging	Het
Obox7	A	T	7: 14,664,398	D79V	probably damaging	Het
Olfr167	G	A	16: 19,514,836	P267S	probably damaging	Het
Olfr374	G	A	8: 72,109,854	G96D	probably benign	Het
Olfr435	T	A	6: 43,201,980	V112D	possibly damaging	Het
Pan2	T	C	10: 128,320,413	V1171A	probably damaging	Het
Parp8	T	A	13: 116,910,913	I208F	probably damaging	Het
Pdgfc	C	T	3: 81,209,245	T302I	probably damaging	Het
Pnpt1	A	G	11: 29,141,256	I337V	probably benign	Het
Polk	T	C	13: 96,489,228	E436G	probably damaging	Het
Pramel7	A	G	2: 87,491,121	V190A	probably benign	Het
Rplp2	T	C	7: 141,448,781		probably benign	Het
Sec23ip	T	A	7: 128,766,273	S670T	probably damaging	Het
Sgk2	A	G	2: 163,004,160	N207S	probably benign	Het
Sh2d2a	C	T	3: 87,851,816	Q242*	probably null	Het
Sh3pxd2b	A	C	11: 32,422,138	N435T	probably damaging	Het
Slc36a4	T	A	9: 15,734,210	V311D	probably damaging	Het
Stx17	G	A	4: 48,181,553	V241M	probably benign	Het
Taok3	A	T	5: 117,265,924	K721N	probably damaging	Het
Tbxas1	A	G	6: 38,948,641		probably benign	Het
Tmem87a	G	A	2: 120,374,504	A377V	probably benign	Het
Topaz1	C	T	9: 122,747,362	T6M	unknown	Het
Tspan8	A	G	10: 115,844,130	I217V	probably benign	Het
Vmn2r125	A	G	4: 156,354,591		probably null	Het
Vmn2r5	C	T	3: 64,504,221	E309K	probably damaging	Het
Wdr59	A	T	8: 111,458,638	C888S	probably benign	Het

Other mutations in Nr4a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01362:Nr4a3	APN	4	48051586	missense	possibly damaging	0.48
IGL01407:Nr4a3	APN	4	48083201	missense	probably benign	0.00
IGL01454:Nr4a3	APN	4	48067803	missense	probably damaging	1.00
IGL01472:Nr4a3	APN	4	48071133	missense	probably damaging	1.00
IGL02622:Nr4a3	APN	4	48051649	missense	probably benign	0.06
IGL03401:Nr4a3	APN	4	48070987	splice site	probably null
bulbous	UTSW	4	48083255	missense	probably damaging	0.98
cronus	UTSW	4	48056539	missense	probably damaging	1.00
I1329:Nr4a3	UTSW	4	48051585	missense	probably benign	0.12
R0486:Nr4a3	UTSW	4	48056525	splice site	probably benign
R0610:Nr4a3	UTSW	4	48051903	missense	probably benign	0.10
R1170:Nr4a3	UTSW	4	48051564	missense	probably damaging	0.98
R1170:Nr4a3	UTSW	4	48083324	missense	probably benign	0.01
R1440:Nr4a3	UTSW	4	48051777	missense	probably benign
R2016:Nr4a3	UTSW	4	48083252	missense	probably damaging	1.00
R2046:Nr4a3	UTSW	4	48067807	missense	possibly damaging	0.82
R2055:Nr4a3	UTSW	4	48067771	missense	possibly damaging	0.86
R3707:Nr4a3	UTSW	4	48056699	missense	probably damaging	0.99
R3708:Nr4a3	UTSW	4	48056699	missense	probably damaging	0.99
R4246:Nr4a3	UTSW	4	48083125	missense	possibly damaging	0.86
R4657:Nr4a3	UTSW	4	48051522	missense	probably damaging	1.00
R4870:Nr4a3	UTSW	4	48051651	missense	possibly damaging	0.73
R5434:Nr4a3	UTSW	4	48067861	missense	probably damaging	1.00
R5539:Nr4a3	UTSW	4	48056525	splice site	probably null
R5663:Nr4a3	UTSW	4	48055931	missense	probably damaging	1.00
R6513:Nr4a3	UTSW	4	48083255	missense	probably damaging	0.98
R6664:Nr4a3	UTSW	4	48056006	missense	probably damaging	1.00
R6921:Nr4a3	UTSW	4	48051486	missense	probably benign	0.04
R6940:Nr4a3	UTSW	4	48051486	missense	probably benign	0.04
R7076:Nr4a3	UTSW	4	48055957	missense	probably damaging	1.00
R7322:Nr4a3	UTSW	4	48083238	missense	probably benign	0.00
R7347:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7348:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7349:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7361:Nr4a3	UTSW	4	48083203	missense	probably benign	0.00
R7365:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7366:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7418:Nr4a3	UTSW	4	48051476	missense	probably damaging	1.00
R7659:Nr4a3	UTSW	4	48051269	missense	probably damaging	1.00
R7895:Nr4a3	UTSW	4	48051390	missense	probably benign
R7986:Nr4a3	UTSW	4	48055954	missense	probably damaging	1.00
R8022:Nr4a3	UTSW	4	48051510	missense	probably damaging	1.00
R8226:Nr4a3	UTSW	4	48056588	missense	probably damaging	1.00
R8328:Nr4a3	UTSW	4	48051323	missense	probably damaging	1.00
R8349:Nr4a3	UTSW	4	48052170	missense	probably benign	0.40
R8403:Nr4a3	UTSW	4	48051348	missense	probably damaging	1.00
R8449:Nr4a3	UTSW	4	48052170	missense	probably benign	0.40

Predicted Primers

PCR Primer
(F):5'- GCAGTACCTGTGGAATACATTCAC -3'
(R):5'- GTCACTTTGGCTAGGGAGATC -3'

Sequencing Primer
(F):5'- CCCTCCAAGAATAATCTCTGAGG -3'
(R):5'- CACTTTGGCTAGGGAGATCTGGAC -3'

Posted On

2014-08-25