Incidental Mutation 'R6220:Mst1r'
ID 503955
Institutional Source Beutler Lab
Gene Symbol Mst1r
Ensembl Gene ENSMUSG00000032584
Gene Name macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
Synonyms Fv-2, Ron, CDw136, Fv2, friend virus susceptibility 2, PTK8, STK
MMRRC Submission 044352-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock # R6220 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 107906873-107920383 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 107907348 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 68 (N68K)
Ref Sequence ENSEMBL: ENSMUSP00000035203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035202] [ENSMUST00000035203] [ENSMUST00000191906] [ENSMUST00000195617]
AlphaFold Q62190
Predicted Effect probably benign
Transcript: ENSMUST00000035202
SMART Domains Protein: ENSMUSP00000035202
Gene: ENSMUSG00000032583

DomainStartEndE-ValueType
Pfam:Mon1 151 555 1.2e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035203
AA Change: N68K

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000035203
Gene: ENSMUSG00000032584
AA Change: N68K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 510 9.03e-116 SMART
PSI 528 570 8.72e-4 SMART
IPT 570 684 1.63e-18 SMART
IPT 685 769 4.03e-23 SMART
IPT 771 873 8.41e-12 SMART
IPT 878 972 5.36e0 SMART
TyrKc 1059 1318 8.2e-134 SMART
low complexity region 1349 1360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158380
Predicted Effect probably benign
Transcript: ENSMUST00000191906
SMART Domains Protein: ENSMUSP00000141516
Gene: ENSMUSG00000032583

DomainStartEndE-ValueType
Pfam:Mon1 146 461 1.1e-138 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195617
AA Change: N68K

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000142201
Gene: ENSMUSG00000032584
AA Change: N68K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 57 442 3.5e-63 SMART
Meta Mutation Damage Score 0.0872 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes a precursor protein that is proteolytically cleaved to yield an alpha chain and a beta chain which form a membrane-spanning heterodimer. The encoded protein belongs to a family of cell-surface receptor tyrosine kinases involved in signaling from the cell surface to the intracellular environment. The binding of the encoded protein to its ligand, macrophage-stimulating protein, mediates several biological activities including wound healing, tumor immunity, macrophage activation and hematopoiesis as well as cell growth, motility, survival and adhesion. The protein encoded by this gene also functions in early development and the macrophage-mediated inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: This locus controls susceptibility to splenomegaly or spleen focus formation induced by inoculation with Friend leukemia virus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik T C 19: 45,846,115 E618G possibly damaging Het
Abhd16b A G 2: 181,493,785 D160G probably damaging Het
Acap1 A G 11: 69,889,679 F15S probably damaging Het
Adam30 A T 3: 98,161,309 S153C probably damaging Het
Afp A T 5: 90,504,410 D420V possibly damaging Het
Ak9 T A 10: 41,370,099 H729Q unknown Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Bcr A G 10: 75,062,292 T423A probably benign Het
Cc2d1b C T 4: 108,633,225 R825W probably damaging Het
Ctns T C 11: 73,193,128 T23A probably benign Het
Ddx54 T A 5: 120,620,689 N332K probably benign Het
Dysf T A 6: 84,149,745 I1344N probably damaging Het
Elovl3 A T 19: 46,134,500 M172L probably benign Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Filip1l T A 16: 57,569,989 N313K probably benign Het
Foxp2 C A 6: 15,437,948 T716K probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm10645 A G 8: 83,165,757 probably benign Het
Gm10735 T C 13: 113,041,496 probably benign Het
Gm4847 A T 1: 166,634,972 D316E probably damaging Het
Gorasp2 T C 2: 70,690,790 L388P probably damaging Het
Heatr5b A G 17: 78,773,677 L1382P probably damaging Het
Herc1 A G 9: 66,433,788 Y1729C probably damaging Het
Ifi207 A T 1: 173,729,546 L542H probably damaging Het
Ighv3-5 T A 12: 114,262,718 N96I probably damaging Het
Isl1 T C 13: 116,303,267 T182A probably benign Het
Jph4 T C 14: 55,110,085 E421G probably benign Het
Lrrc45 T C 11: 120,719,527 I488T probably benign Het
Mroh8 A G 2: 157,233,163 I471T probably benign Het
Ms4a2 A T 19: 11,617,563 D96E probably damaging Het
Myo18b A G 5: 112,757,507 M2075T possibly damaging Het
Neb T C 2: 52,270,972 K2229R probably null Het
Nkx6-3 T A 8: 23,153,971 probably null Het
Nlrp1a C A 11: 71,142,338 S10I probably benign Het
Npas2 A T 1: 39,336,061 T487S probably benign Het
Nrxn1 G C 17: 91,088,476 T84R probably benign Het
Olfr730 C A 14: 50,186,678 D180Y probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh18 A G 3: 49,745,251 C921R probably damaging Het
Pcdha9 A G 18: 36,998,478 Y200C probably damaging Het
Pknox1 A T 17: 31,603,203 R315* probably null Het
Rasgrp1 C T 2: 117,284,929 W726* probably null Het
Rassf8 G A 6: 145,817,133 R402H probably damaging Het
Rev3l T A 10: 39,822,779 Y1091N probably damaging Het
Riok3 T G 18: 12,149,551 V349G probably damaging Het
Rps18 A T 17: 33,955,136 V15E probably damaging Het
Rptor A T 11: 119,897,442 Y1323F possibly damaging Het
Rspry1 T C 8: 94,658,750 C437R probably damaging Het
Sema5a T A 15: 32,686,729 Y996N probably damaging Het
Smarcad1 A G 6: 65,114,329 I1011M probably benign Het
Supv3l1 A T 10: 62,439,021 M295K possibly damaging Het
Sv2c T C 13: 95,976,626 D605G probably damaging Het
Teddm1b G A 1: 153,875,201 W252* probably null Het
Tes T A 6: 17,086,196 C29* probably null Het
Thsd4 A G 9: 59,982,747 W856R probably damaging Het
Treml4 A T 17: 48,264,848 D93V possibly damaging Het
Trim66 T C 7: 109,483,093 T218A probably damaging Het
Tssk5 T C 15: 76,373,773 D128G probably damaging Het
Ubr3 T A 2: 70,020,475 W1746R probably damaging Het
Vmn2r11 T C 5: 109,053,568 I357V probably benign Het
Vmn2r87 A T 10: 130,479,938 D86E probably benign Het
Zfp184 T G 13: 21,960,207 H694Q probably damaging Het
Zranb3 A C 1: 127,999,404 F341L probably benign Het
Other mutations in Mst1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Mst1r APN 9 107913250 splice site probably benign
IGL01327:Mst1r APN 9 107907844 missense probably benign 0.03
IGL01572:Mst1r APN 9 107911592 missense probably damaging 1.00
IGL01968:Mst1r APN 9 107916806 splice site probably null
IGL01983:Mst1r APN 9 107917276 missense probably damaging 0.99
IGL02096:Mst1r APN 9 107917279 missense probably damaging 0.97
IGL02203:Mst1r APN 9 107913149 missense possibly damaging 0.61
IGL02203:Mst1r APN 9 107907869 missense probably damaging 1.00
IGL02332:Mst1r APN 9 107907826 nonsense probably null
IGL02402:Mst1r APN 9 107916827 missense probably damaging 0.99
IGL02404:Mst1r APN 9 107913067 splice site probably benign
IGL02942:Mst1r APN 9 107913153 missense possibly damaging 0.89
IGL02951:Mst1r APN 9 107908204 missense possibly damaging 0.88
IGL02975:Mst1r APN 9 107913180 missense probably benign 0.20
IGL03005:Mst1r APN 9 107914549 nonsense probably null
IGL03304:Mst1r APN 9 107907938 missense probably damaging 1.00
R0386:Mst1r UTSW 9 107916804 splice site probably null
R0833:Mst1r UTSW 9 107913167 missense probably benign
R0833:Mst1r UTSW 9 107914776 missense probably benign 0.00
R1139:Mst1r UTSW 9 107919969 missense possibly damaging 0.93
R1371:Mst1r UTSW 9 107917225 missense probably damaging 1.00
R1477:Mst1r UTSW 9 107908324 missense probably benign
R1479:Mst1r UTSW 9 107913345 splice site probably benign
R1541:Mst1r UTSW 9 107917363 missense probably damaging 0.99
R1698:Mst1r UTSW 9 107919980 missense probably benign 0.06
R1891:Mst1r UTSW 9 107913462 missense probably damaging 1.00
R1971:Mst1r UTSW 9 107913212 missense probably benign 0.06
R1974:Mst1r UTSW 9 107914763 missense probably damaging 1.00
R1974:Mst1r UTSW 9 107915933 critical splice donor site probably null
R2144:Mst1r UTSW 9 107913168 missense probably benign
R2221:Mst1r UTSW 9 107908348 missense probably damaging 1.00
R2356:Mst1r UTSW 9 107917870 missense probably damaging 1.00
R3913:Mst1r UTSW 9 107914746 missense probably benign
R4768:Mst1r UTSW 9 107911650 missense probably damaging 1.00
R4793:Mst1r UTSW 9 107919925 missense probably damaging 0.96
R5141:Mst1r UTSW 9 107912241 missense probably damaging 0.99
R5191:Mst1r UTSW 9 107911551 missense probably damaging 0.98
R5238:Mst1r UTSW 9 107907574 missense probably damaging 1.00
R6024:Mst1r UTSW 9 107908151 missense probably benign 0.00
R6256:Mst1r UTSW 9 107917266 missense probably damaging 1.00
R6361:Mst1r UTSW 9 107915853 missense probably benign
R6522:Mst1r UTSW 9 107913239 missense probably benign 0.00
R6559:Mst1r UTSW 9 107908271 missense possibly damaging 0.91
R6863:Mst1r UTSW 9 107920026 missense probably benign
R6868:Mst1r UTSW 9 107915933 critical splice donor site probably null
R6873:Mst1r UTSW 9 107911644 missense possibly damaging 0.90
R6978:Mst1r UTSW 9 107912594 missense probably benign 0.23
R7168:Mst1r UTSW 9 107908193 missense probably benign 0.01
R7299:Mst1r UTSW 9 107914790 missense possibly damaging 0.46
R7301:Mst1r UTSW 9 107914790 missense possibly damaging 0.46
R7405:Mst1r UTSW 9 107915122 missense possibly damaging 0.87
R7615:Mst1r UTSW 9 107920012 missense probably benign 0.05
R7684:Mst1r UTSW 9 107911563 missense probably benign 0.01
R7741:Mst1r UTSW 9 107907120 start gained probably benign
R7916:Mst1r UTSW 9 107907578 missense probably damaging 1.00
R7987:Mst1r UTSW 9 107912798 splice site probably null
R8177:Mst1r UTSW 9 107907585 missense probably damaging 1.00
R8356:Mst1r UTSW 9 107917264 missense probably damaging 1.00
R8494:Mst1r UTSW 9 107914519 missense possibly damaging 0.90
R8692:Mst1r UTSW 9 107914851 missense possibly damaging 0.82
R8979:Mst1r UTSW 9 107915279 missense probably damaging 0.98
R9012:Mst1r UTSW 9 107914761 missense probably benign 0.01
X0026:Mst1r UTSW 9 107913203 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCCTGGACCTTCTGGGATTC -3'
(R):5'- TAGCACCAGTGTGTCTGTGTC -3'

Sequencing Primer
(F):5'- TCAATGGGGCTGCCTCTG -3'
(R):5'- CACCAGTGTGTCTGTGTCCTTTG -3'
Posted On 2018-02-27