Mutagenetix > Incidental Mutation

Incidental Mutation 'R6220:Mst1r'

503955

Institutional Source

Beutler Lab

Gene Symbol

Mst1r

Ensembl Gene

ENSMUSG00000032584

Gene Name

macrophage stimulating 1 receptor (c-met-related tyrosine kinase)

Synonyms

Fv-2, Ron, CDw136, Fv2, friend virus susceptibility 2, PTK8, STK

MMRRC Submission

044352-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.250) question?

Stock #

R6220 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

107906873-107920383 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 107907348 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 68 (N68K)

Ref Sequence

ENSEMBL: ENSMUSP00000035203 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035202] [ENSMUST00000035203] [ENSMUST00000191906] [ENSMUST00000195617]

AlphaFold

Q62190

Predicted Effect

probably benign
Transcript: ENSMUST00000035202

SMART Domains

Protein: ENSMUSP00000035202
Gene: ENSMUSG00000032583

Domain	Start	End	E-Value	Type
Pfam:Mon1	151	555	1.2e-142	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000035203
AA Change: N68K

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000035203
Gene: ENSMUSG00000032584
AA Change: N68K

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	57	510	9.03e-116	SMART
PSI	528	570	8.72e-4	SMART
IPT	570	684	1.63e-18	SMART
IPT	685	769	4.03e-23	SMART
IPT	771	873	8.41e-12	SMART
IPT	878	972	5.36e0	SMART
TyrKc	1059	1318	8.2e-134	SMART
low complexity region	1349	1360	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158380

Predicted Effect

probably benign
Transcript: ENSMUST00000191906

SMART Domains

Protein: ENSMUSP00000141516
Gene: ENSMUSG00000032583

Domain	Start	End	E-Value	Type
Pfam:Mon1	146	461	1.1e-138	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195617
AA Change: N68K

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000142201
Gene: ENSMUSG00000032584
AA Change: N68K

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	57	442	3.5e-63	SMART

Meta Mutation Damage Score

0.0872

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: This gene encodes a precursor protein that is proteolytically cleaved to yield an alpha chain and a beta chain which form a membrane-spanning heterodimer. The encoded protein belongs to a family of cell-surface receptor tyrosine kinases involved in signaling from the cell surface to the intracellular environment. The binding of the encoded protein to its ligand, macrophage-stimulating protein, mediates several biological activities including wound healing, tumor immunity, macrophage activation and hematopoiesis as well as cell growth, motility, survival and adhesion. The protein encoded by this gene also functions in early development and the macrophage-mediated inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: This locus controls susceptibility to splenomegaly or spleen focus formation induced by inoculation with Friend leukemia virus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	T	C	19: 45,846,115	E618G	possibly damaging	Het
Abhd16b	A	G	2: 181,493,785	D160G	probably damaging	Het
Acap1	A	G	11: 69,889,679	F15S	probably damaging	Het
Adam30	A	T	3: 98,161,309	S153C	probably damaging	Het
Afp	A	T	5: 90,504,410	D420V	possibly damaging	Het
Ak9	T	A	10: 41,370,099	H729Q	unknown	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Bcr	A	G	10: 75,062,292	T423A	probably benign	Het
Cc2d1b	C	T	4: 108,633,225	R825W	probably damaging	Het
Ctns	T	C	11: 73,193,128	T23A	probably benign	Het
Ddx54	T	A	5: 120,620,689	N332K	probably benign	Het
Dysf	T	A	6: 84,149,745	I1344N	probably damaging	Het
Elovl3	A	T	19: 46,134,500	M172L	probably benign	Het
Fbxo6	A	T	4: 148,149,522	I39N	probably damaging	Het
Filip1l	T	A	16: 57,569,989	N313K	probably benign	Het
Foxp2	C	A	6: 15,437,948	T716K	probably damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm10645	A	G	8: 83,165,757		probably benign	Het
Gm10735	T	C	13: 113,041,496		probably benign	Het
Gm4847	A	T	1: 166,634,972	D316E	probably damaging	Het
Gorasp2	T	C	2: 70,690,790	L388P	probably damaging	Het
Heatr5b	A	G	17: 78,773,677	L1382P	probably damaging	Het
Herc1	A	G	9: 66,433,788	Y1729C	probably damaging	Het
Ifi207	A	T	1: 173,729,546	L542H	probably damaging	Het
Ighv3-5	T	A	12: 114,262,718	N96I	probably damaging	Het
Isl1	T	C	13: 116,303,267	T182A	probably benign	Het
Jph4	T	C	14: 55,110,085	E421G	probably benign	Het
Lrrc45	T	C	11: 120,719,527	I488T	probably benign	Het
Mroh8	A	G	2: 157,233,163	I471T	probably benign	Het
Ms4a2	A	T	19: 11,617,563	D96E	probably damaging	Het
Myo18b	A	G	5: 112,757,507	M2075T	possibly damaging	Het
Neb	T	C	2: 52,270,972	K2229R	probably null	Het
Nkx6-3	T	A	8: 23,153,971		probably null	Het
Nlrp1a	C	A	11: 71,142,338	S10I	probably benign	Het
Npas2	A	T	1: 39,336,061	T487S	probably benign	Het
Nrxn1	G	C	17: 91,088,476	T84R	probably benign	Het
Olfr730	C	A	14: 50,186,678	D180Y	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pcdh18	A	G	3: 49,745,251	C921R	probably damaging	Het
Pcdha9	A	G	18: 36,998,478	Y200C	probably damaging	Het
Pknox1	A	T	17: 31,603,203	R315*	probably null	Het
Rasgrp1	C	T	2: 117,284,929	W726*	probably null	Het
Rassf8	G	A	6: 145,817,133	R402H	probably damaging	Het
Rev3l	T	A	10: 39,822,779	Y1091N	probably damaging	Het
Riok3	T	G	18: 12,149,551	V349G	probably damaging	Het
Rps18	A	T	17: 33,955,136	V15E	probably damaging	Het
Rptor	A	T	11: 119,897,442	Y1323F	possibly damaging	Het
Rspry1	T	C	8: 94,658,750	C437R	probably damaging	Het
Sema5a	T	A	15: 32,686,729	Y996N	probably damaging	Het
Smarcad1	A	G	6: 65,114,329	I1011M	probably benign	Het
Supv3l1	A	T	10: 62,439,021	M295K	possibly damaging	Het
Sv2c	T	C	13: 95,976,626	D605G	probably damaging	Het
Teddm1b	G	A	1: 153,875,201	W252*	probably null	Het
Tes	T	A	6: 17,086,196	C29*	probably null	Het
Thsd4	A	G	9: 59,982,747	W856R	probably damaging	Het
Treml4	A	T	17: 48,264,848	D93V	possibly damaging	Het
Trim66	T	C	7: 109,483,093	T218A	probably damaging	Het
Tssk5	T	C	15: 76,373,773	D128G	probably damaging	Het
Ubr3	T	A	2: 70,020,475	W1746R	probably damaging	Het
Vmn2r11	T	C	5: 109,053,568	I357V	probably benign	Het
Vmn2r87	A	T	10: 130,479,938	D86E	probably benign	Het
Zfp184	T	G	13: 21,960,207	H694Q	probably damaging	Het
Zranb3	A	C	1: 127,999,404	F341L	probably benign	Het

Other mutations in Mst1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Mst1r	APN	9	107913250	splice site	probably benign
IGL01327:Mst1r	APN	9	107907844	missense	probably benign	0.03
IGL01572:Mst1r	APN	9	107911592	missense	probably damaging	1.00
IGL01968:Mst1r	APN	9	107916806	splice site	probably null
IGL01983:Mst1r	APN	9	107917276	missense	probably damaging	0.99
IGL02096:Mst1r	APN	9	107917279	missense	probably damaging	0.97
IGL02203:Mst1r	APN	9	107913149	missense	possibly damaging	0.61
IGL02203:Mst1r	APN	9	107907869	missense	probably damaging	1.00
IGL02332:Mst1r	APN	9	107907826	nonsense	probably null
IGL02402:Mst1r	APN	9	107916827	missense	probably damaging	0.99
IGL02404:Mst1r	APN	9	107913067	splice site	probably benign
IGL02942:Mst1r	APN	9	107913153	missense	possibly damaging	0.89
IGL02951:Mst1r	APN	9	107908204	missense	possibly damaging	0.88
IGL02975:Mst1r	APN	9	107913180	missense	probably benign	0.20
IGL03005:Mst1r	APN	9	107914549	nonsense	probably null
IGL03304:Mst1r	APN	9	107907938	missense	probably damaging	1.00
R0386:Mst1r	UTSW	9	107916804	splice site	probably null
R0833:Mst1r	UTSW	9	107913167	missense	probably benign
R0833:Mst1r	UTSW	9	107914776	missense	probably benign	0.00
R1139:Mst1r	UTSW	9	107919969	missense	possibly damaging	0.93
R1371:Mst1r	UTSW	9	107917225	missense	probably damaging	1.00
R1477:Mst1r	UTSW	9	107908324	missense	probably benign
R1479:Mst1r	UTSW	9	107913345	splice site	probably benign
R1541:Mst1r	UTSW	9	107917363	missense	probably damaging	0.99
R1698:Mst1r	UTSW	9	107919980	missense	probably benign	0.06
R1891:Mst1r	UTSW	9	107913462	missense	probably damaging	1.00
R1971:Mst1r	UTSW	9	107913212	missense	probably benign	0.06
R1974:Mst1r	UTSW	9	107914763	missense	probably damaging	1.00
R1974:Mst1r	UTSW	9	107915933	critical splice donor site	probably null
R2144:Mst1r	UTSW	9	107913168	missense	probably benign
R2221:Mst1r	UTSW	9	107908348	missense	probably damaging	1.00
R2356:Mst1r	UTSW	9	107917870	missense	probably damaging	1.00
R3913:Mst1r	UTSW	9	107914746	missense	probably benign
R4768:Mst1r	UTSW	9	107911650	missense	probably damaging	1.00
R4793:Mst1r	UTSW	9	107919925	missense	probably damaging	0.96
R5141:Mst1r	UTSW	9	107912241	missense	probably damaging	0.99
R5191:Mst1r	UTSW	9	107911551	missense	probably damaging	0.98
R5238:Mst1r	UTSW	9	107907574	missense	probably damaging	1.00
R6024:Mst1r	UTSW	9	107908151	missense	probably benign	0.00
R6256:Mst1r	UTSW	9	107917266	missense	probably damaging	1.00
R6361:Mst1r	UTSW	9	107915853	missense	probably benign
R6522:Mst1r	UTSW	9	107913239	missense	probably benign	0.00
R6559:Mst1r	UTSW	9	107908271	missense	possibly damaging	0.91
R6863:Mst1r	UTSW	9	107920026	missense	probably benign
R6868:Mst1r	UTSW	9	107915933	critical splice donor site	probably null
R6873:Mst1r	UTSW	9	107911644	missense	possibly damaging	0.90
R6978:Mst1r	UTSW	9	107912594	missense	probably benign	0.23
R7168:Mst1r	UTSW	9	107908193	missense	probably benign	0.01
R7299:Mst1r	UTSW	9	107914790	missense	possibly damaging	0.46
R7301:Mst1r	UTSW	9	107914790	missense	possibly damaging	0.46
R7405:Mst1r	UTSW	9	107915122	missense	possibly damaging	0.87
R7615:Mst1r	UTSW	9	107920012	missense	probably benign	0.05
R7684:Mst1r	UTSW	9	107911563	missense	probably benign	0.01
R7741:Mst1r	UTSW	9	107907120	start gained	probably benign
R7916:Mst1r	UTSW	9	107907578	missense	probably damaging	1.00
R7987:Mst1r	UTSW	9	107912798	splice site	probably null
R8177:Mst1r	UTSW	9	107907585	missense	probably damaging	1.00
R8356:Mst1r	UTSW	9	107917264	missense	probably damaging	1.00
R8494:Mst1r	UTSW	9	107914519	missense	possibly damaging	0.90
R8692:Mst1r	UTSW	9	107914851	missense	possibly damaging	0.82
R8979:Mst1r	UTSW	9	107915279	missense	probably damaging	0.98
R9012:Mst1r	UTSW	9	107914761	missense	probably benign	0.01
X0026:Mst1r	UTSW	9	107913203	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TCCTGGACCTTCTGGGATTC -3'
(R):5'- TAGCACCAGTGTGTCTGTGTC -3'

Sequencing Primer
(F):5'- TCAATGGGGCTGCCTCTG -3'
(R):5'- CACCAGTGTGTCTGTGTCCTTTG -3'

Posted On

2018-02-27