Incidental Mutation 'R8493:Ift122'
ID 658116
Institutional Source Beutler Lab
Gene Symbol Ift122
Ensembl Gene ENSMUSG00000030323
Gene Name intraflagellar transport 122
Synonyms C86139, sopb, Wdr10
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8493 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 115853470-115926699 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 115910331 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 713 (I713N)
Ref Sequence ENSEMBL: ENSMUSP00000045468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038234] [ENSMUST00000112923] [ENSMUST00000112925] [ENSMUST00000141305]
AlphaFold Q6NWV3
Predicted Effect probably benign
Transcript: ENSMUST00000038234
AA Change: I713N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000045468
Gene: ENSMUSG00000030323
AA Change: I713N

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000108545
Gene: ENSMUSG00000030323
AA Change: I772N

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
Blast:WD40 163 267 3e-46 BLAST
WD40 269 308 1.91e1 SMART
WD40 310 349 3.45e-3 SMART
WD40 507 542 1.43e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112925
AA Change: I713N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000108547
Gene: ENSMUSG00000030323
AA Change: I713N

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141305
SMART Domains Protein: ENSMUSP00000138535
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
low complexity region 124 134 N/A INTRINSIC
low complexity region 162 176 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This cytoplasmic protein contains seven WD repeats and an AF-2 domain which function by recruiting coregulatory molecules and in transcriptional activation. Mutations in this gene cause cranioectodermal dysplasia-1. A related pseudogene is located on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a null mutation display embryonic lethality during organogenesis with exencephaly, a ventralized caudal neural tube, preaxial polydactyly, abnormal cilia, and left-right patterning defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,835,589 M1L unknown Het
4933402N22Rik T C 5: 11,921,522 L147P probably damaging Het
Abca13 T A 11: 9,510,668 I4226N probably damaging Het
Ankrd10 C A 8: 11,628,518 E125* probably null Het
Apob A T 12: 8,009,009 D2497V possibly damaging Het
Arap1 G A 7: 101,386,518 W87* probably null Het
Arhgef37 C T 18: 61,507,206 V261I probably benign Het
Arl4a A C 12: 40,036,473 C92G probably benign Het
Arrdc2 C T 8: 70,836,857 probably null Het
Atg16l1 A C 1: 87,778,982 T355P probably damaging Het
Card14 T G 11: 119,333,609 probably null Het
Cd109 G A 9: 78,657,519 V249I probably benign Het
Cdhr4 A G 9: 107,996,254 D395G probably damaging Het
Celsr1 C A 15: 85,938,006 M1703I possibly damaging Het
Cfap157 A G 2: 32,779,740 I277T probably benign Het
Chst4 A G 8: 110,030,463 V173A probably damaging Het
Clca4b T C 3: 144,912,150 N731D probably benign Het
Col11a2 A G 17: 34,059,962 E1122G possibly damaging Het
Csf1r C G 18: 61,114,882 P341A probably damaging Het
Dclk3 A G 9: 111,468,147 E253G probably benign Het
Dnah2 T A 11: 69,452,978 D2829V probably damaging Het
Dnah7a T C 1: 53,472,908 N2998S probably damaging Het
Ehbp1 C T 11: 22,285,842 probably benign Het
Eprs A T 1: 185,407,174 K919* probably null Het
Esp16 A T 17: 39,539,930 K67* probably null Het
Fam169a G T 13: 97,122,859 E474D probably benign Het
Fam83h C T 15: 76,002,653 R945H probably benign Het
Flnb T A 14: 7,869,822 V195E probably damaging Het
Gm3159 T C 14: 4,398,567 I86T probably damaging Het
Gm3259 C T 5: 95,340,233 H9Y possibly damaging Het
Gm4070 A G 7: 105,898,881 S1655P probably benign Het
Gm4744 G A 6: 40,949,347 S103F Het
Ilkap A G 1: 91,378,544 I105T probably damaging Het
Isl1 G T 13: 116,305,299 H133N possibly damaging Het
Jade1 T A 3: 41,604,678 L398Q possibly damaging Het
Kcnh7 C T 2: 62,850,659 V195M probably benign Het
Kif3a A T 11: 53,598,800 K669* probably null Het
L3mbtl4 G A 17: 68,630,244 R420H probably damaging Het
Mrgprb1 A T 7: 48,447,573 I197N probably damaging Het
Mthfd1 A G 12: 76,294,155 T263A probably damaging Het
Mtmr7 G A 8: 40,606,884 A62V possibly damaging Het
Naxe A G 3: 88,058,450 probably benign Het
Ndufs2 T C 1: 171,241,108 T51A probably benign Het
Nlrc5 T A 8: 94,523,220 L1824Q probably damaging Het
Notch1 A G 2: 26,472,239 V27A unknown Het
Nucks1 A T 1: 131,929,735 M169L probably benign Het
Olfr1115 T A 2: 87,252,871 D311E probably benign Het
Olfr1128 T A 2: 87,544,770 Y258F probably damaging Het
Olfr1253 T A 2: 89,752,255 Y191F probably benign Het
Olfr1295 T A 2: 111,564,979 H155L probably damaging Het
Olfr1342 C T 4: 118,690,032 S140N probably benign Het
Olfr612 A T 7: 103,538,272 S321T probably benign Het
Olfr659 G T 7: 104,670,815 V38L probably benign Het
Pcnt C T 10: 76,403,623 probably null Het
Pdcd7 T C 9: 65,346,757 S206P probably benign Het
Pdia4 A T 6: 47,796,641 Y591* probably null Het
Plxna4 C T 6: 32,215,712 M771I probably benign Het
Ptpn13 A G 5: 103,564,165 Y1643C probably damaging Het
Ptpn13 A G 5: 103,569,805 I1906V probably benign Het
Rab33b T A 3: 51,484,374 S15T probably benign Het
Rasip1 A T 7: 45,635,043 M644L possibly damaging Het
Rnf4 G A 5: 34,348,691 C55Y probably damaging Het
Sel1l A T 12: 91,813,961 Y585* probably null Het
Slc40a1 A T 1: 45,911,416 F292Y probably damaging Het
Smarca4 G A 9: 21,658,848 D716N probably damaging Het
Sp7 T A 15: 102,358,402 H323L possibly damaging Het
Sprtn A G 8: 124,903,194 S409G probably benign Het
St3gal2 T G 8: 110,962,221 L131R probably damaging Het
Tctn1 A G 5: 122,261,489 C91R probably damaging Het
Tgm1 A T 14: 55,700,297 V785E probably damaging Het
Tmem8 G T 17: 26,121,957 R678L probably damaging Het
Topaz1 G T 9: 122,750,508 V828L probably benign Het
Triobp C T 15: 78,994,126 H1750Y possibly damaging Het
Ttc27 G A 17: 74,743,052 probably null Het
Usp2 G A 9: 44,076,053 G216D possibly damaging Het
Vmn2r99 A G 17: 19,393,758 D580G probably benign Het
Wbp1l G A 19: 46,652,549 R106H possibly damaging Het
Zmym2 G T 14: 56,914,149 C497F probably damaging Het
Other mutations in Ift122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Ift122 APN 6 115917057 missense probably benign 0.10
IGL00783:Ift122 APN 6 115905902 missense probably benign
IGL00784:Ift122 APN 6 115905902 missense probably benign
IGL00799:Ift122 APN 6 115877536 missense probably damaging 1.00
IGL00908:Ift122 APN 6 115913909 missense probably benign 0.00
IGL01012:Ift122 APN 6 115899491 missense probably damaging 0.99
IGL01444:Ift122 APN 6 115884379 missense probably benign 0.08
IGL01451:Ift122 APN 6 115912604 critical splice donor site probably null
IGL01940:Ift122 APN 6 115887371 splice site probably benign
IGL02089:Ift122 APN 6 115925437 missense probably benign 0.00
IGL02331:Ift122 APN 6 115887324 missense probably damaging 1.00
IGL02929:Ift122 APN 6 115902877 missense probably damaging 1.00
IGL03169:Ift122 APN 6 115905961 splice site probably benign
PIT1430001:Ift122 UTSW 6 115925744 splice site probably benign
R0158:Ift122 UTSW 6 115924484 splice site probably benign
R0496:Ift122 UTSW 6 115905902 missense probably benign
R1065:Ift122 UTSW 6 115875325 splice site probably null
R1670:Ift122 UTSW 6 115923883 missense probably benign 0.05
R1861:Ift122 UTSW 6 115891928 missense probably damaging 1.00
R1889:Ift122 UTSW 6 115894421 critical splice donor site probably null
R1990:Ift122 UTSW 6 115924367 missense probably damaging 1.00
R2362:Ift122 UTSW 6 115884350 missense probably damaging 0.99
R2385:Ift122 UTSW 6 115912522 missense probably benign 0.21
R3734:Ift122 UTSW 6 115925501 splice site probably benign
R3800:Ift122 UTSW 6 115925906 missense probably benign 0.03
R3981:Ift122 UTSW 6 115913921 missense probably benign 0.02
R4289:Ift122 UTSW 6 115923891 missense probably damaging 1.00
R4545:Ift122 UTSW 6 115890588 missense probably damaging 1.00
R4546:Ift122 UTSW 6 115890588 missense probably damaging 1.00
R4641:Ift122 UTSW 6 115888765 nonsense probably null
R4815:Ift122 UTSW 6 115881556 missense possibly damaging 0.95
R4854:Ift122 UTSW 6 115862746 missense possibly damaging 0.61
R4928:Ift122 UTSW 6 115915858 utr 3 prime probably benign
R5021:Ift122 UTSW 6 115864372 missense probably benign 0.41
R5121:Ift122 UTSW 6 115912534 missense probably benign 0.04
R5200:Ift122 UTSW 6 115920379 missense probably damaging 0.99
R5549:Ift122 UTSW 6 115892022 missense probably damaging 1.00
R6111:Ift122 UTSW 6 115875286 missense probably damaging 1.00
R6141:Ift122 UTSW 6 115916011 missense probably damaging 0.99
R6766:Ift122 UTSW 6 115926243 missense probably benign 0.15
R7379:Ift122 UTSW 6 115926302 missense probably benign
R7402:Ift122 UTSW 6 115894322 missense probably benign 0.00
R7436:Ift122 UTSW 6 115926302 missense probably benign
R7437:Ift122 UTSW 6 115926302 missense probably benign
R7438:Ift122 UTSW 6 115926302 missense probably benign
R7517:Ift122 UTSW 6 115890582 missense probably benign 0.37
R7978:Ift122 UTSW 6 115920352 missense probably benign 0.37
R8492:Ift122 UTSW 6 115887005 missense probably benign 0.02
R8669:Ift122 UTSW 6 115923291 missense probably damaging 0.98
R8867:Ift122 UTSW 6 115880671 missense probably damaging 1.00
R8887:Ift122 UTSW 6 115891919 missense probably benign 0.00
R8947:Ift122 UTSW 6 115924407 missense probably benign
R8978:Ift122 UTSW 6 115925808 missense possibly damaging 0.78
R9149:Ift122 UTSW 6 115890531 missense probably damaging 1.00
Z1176:Ift122 UTSW 6 115915994 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTGGAGCTGACGTAATG -3'
(R):5'- TCCCAGAGAACCTAGTCATTTTCATG -3'

Sequencing Primer
(F):5'- AGCTGACGTAATGCTGGCAC -3'
(R):5'- AACCTAGTCATTTTCATGTTTGGTGC -3'
Posted On 2021-01-18