Mutagenetix > Incidental Mutation

Incidental Mutation 'R8528:Enam'

658893

Institutional Source

Beutler Lab

Gene Symbol

Enam

Ensembl Gene

ENSMUSG00000029286

Gene Name

enamelin

Synonyms

abte

MMRRC Submission

068498-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.222) question?

Stock #

R8528 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

88635834-88653908 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 88650078 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 454 (V454E)

Ref Sequence

ENSEMBL: ENSMUSP00000031222 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031222] [ENSMUST00000199104]

AlphaFold

O55196

Predicted Effect

probably damaging
Transcript: ENSMUST00000031222
AA Change: V454E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000031222
Gene: ENSMUSG00000029286
AA Change: V454E

Domain	Start	End	E-Value	Type
low complexity region	25	38	N/A	INTRINSIC
low complexity region	67	114	N/A	INTRINSIC
low complexity region	128	150	N/A	INTRINSIC
low complexity region	159	167	N/A	INTRINSIC
low complexity region	173	187	N/A	INTRINSIC
low complexity region	203	214	N/A	INTRINSIC
Pfam:Enamelin	216	441	5.4e-74	PFAM
Pfam:Enamelin	503	1249	1.9e-303	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000199104
AA Change: V529E

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000142854
Gene: ENSMUSG00000029286
AA Change: V529E

Domain	Start	End	E-Value	Type
low complexity region	100	113	N/A	INTRINSIC
low complexity region	142	189	N/A	INTRINSIC
low complexity region	203	225	N/A	INTRINSIC
low complexity region	234	242	N/A	INTRINSIC
low complexity region	248	262	N/A	INTRINSIC
low complexity region	278	289	N/A	INTRINSIC
Pfam:Enamelin	291	510	2.5e-74	PFAM
Pfam:Enamelin	550	1325	N/A	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dental enamel forms the outer cap of teeth and is the hardest substance found in vertebrates. This gene encodes the largest protein in the enamel matrix of developing teeth. The protein is involved in the mineralization and structural organization of enamel. Defects in this gene result in amelogenesis imperfect type 1C.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice lack true enamel due to loss of mineralization at the secretory surface of ameloblasts and mandibular incisors are opaque with a rough surface and abnormal wear on the incisal edge. ENU-induced mutant mice provide models for various clinical subtypes of amelogenesis imperfecta. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb1	A	C	15: 74,447,700 (GRCm39)	I169L	possibly damaging	Het
Ahnak	A	T	19: 8,985,092 (GRCm39)	K2125N	probably damaging	Het
Arl5b	T	A	2: 15,078,138 (GRCm39)		probably null	Het
Ccng2	T	C	5: 93,417,164 (GRCm39)	V60A	possibly damaging	Het
Cfap65	A	G	1: 74,945,096 (GRCm39)	V1442A	possibly damaging	Het
Cyp1b1	T	A	17: 80,017,993 (GRCm39)	E387D	probably damaging	Het
Dchs2	T	C	3: 83,261,918 (GRCm39)	S2729P	probably damaging	Het
Dnah11	A	G	12: 117,972,538 (GRCm39)	F2882S	probably damaging	Het
Dpy30	T	C	17: 74,606,757 (GRCm39)	D97G	probably benign	Het
Eppk1	C	T	15: 75,994,319 (GRCm39)	R854Q	probably benign	Het
Ero1b	T	A	13: 12,614,757 (GRCm39)	C240*	probably null	Het
Exog	A	G	9: 119,291,686 (GRCm39)	D297G	probably damaging	Het
Fbxl12	C	A	9: 20,550,160 (GRCm39)	R165L	possibly damaging	Het
Fer1l5	A	G	1: 36,456,855 (GRCm39)	Y1611C	possibly damaging	Het
Firrm	T	C	1: 163,813,652 (GRCm39)	K191E	probably damaging	Het
Frmpd1	T	C	4: 45,285,034 (GRCm39)	V1285A	probably benign	Het
Gfpt1	G	C	6: 87,043,770 (GRCm39)		probably null	Het
Gm15446	T	C	5: 110,090,896 (GRCm39)	Y383H	possibly damaging	Het
Gsdmc	A	T	15: 63,649,189 (GRCm39)		probably null	Het
Hao1	A	G	2: 134,364,913 (GRCm39)	I238T	probably damaging	Het
Kcnq5	G	A	1: 21,549,648 (GRCm39)	R360C	probably damaging	Het
Kcnv2	T	A	19: 27,300,387 (GRCm39)	D79E	probably benign	Het
Lrrc8a	T	C	2: 30,145,557 (GRCm39)	Y124H	probably damaging	Het
Lrrc8d	T	A	5: 105,960,352 (GRCm39)	M254K	probably benign	Het
Map3k4	T	C	17: 12,451,821 (GRCm39)	N1489S	probably damaging	Het
Mapk8ip2	A	G	15: 89,339,422 (GRCm39)	D34G	probably damaging	Het
Myo9a	A	G	9: 59,767,423 (GRCm39)	T876A	probably damaging	Het
Pabpc2	C	T	18: 39,908,439 (GRCm39)	T568I	probably benign	Het
Pcdhga2	G	T	18: 37,802,221 (GRCm39)	A22S	probably benign	Het
Rc3h2	G	A	2: 37,272,811 (GRCm39)	T755I	probably benign	Het
Sertad4	A	G	1: 192,533,391 (GRCm39)	V15A	probably benign	Het
Slc28a2	A	G	2: 122,286,223 (GRCm39)	K520E	probably damaging	Het
Slc4a10	T	C	2: 62,127,140 (GRCm39)	V831A	possibly damaging	Het
Sorbs1	G	C	19: 40,365,244 (GRCm39)	R180G	probably benign	Het
Spag17	A	T	3: 100,031,501 (GRCm39)	I2255F	possibly damaging	Het
Sprn	C	T	7: 139,733,423 (GRCm39)		probably benign	Het
Stim1	T	C	7: 102,080,289 (GRCm39)		probably benign	Het
Stk24	C	A	14: 121,529,447 (GRCm39)	A402S	probably benign	Het
Sycp2	A	G	2: 178,016,326 (GRCm39)	L712P	probably damaging	Het
Tenm3	C	T	8: 48,795,668 (GRCm39)	G269S	probably damaging	Het
Zdbf2	A	G	1: 63,342,545 (GRCm39)	E308G	possibly damaging	Het
Zfp442	A	C	2: 150,250,962 (GRCm39)	H312Q	probably damaging	Het

Other mutations in Enam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00769:Enam	APN	5	88,649,343 (GRCm39)	missense	possibly damaging	0.83
IGL01611:Enam	APN	5	88,651,608 (GRCm39)	missense	probably damaging	0.99
IGL01802:Enam	APN	5	88,651,533 (GRCm39)	missense	possibly damaging	0.93
IGL02220:Enam	APN	5	88,652,418 (GRCm39)	nonsense	probably null
IGL02371:Enam	APN	5	88,650,668 (GRCm39)	missense	probably benign	0.39
IGL02596:Enam	APN	5	88,650,885 (GRCm39)	missense	probably benign	0.01
IGL03026:Enam	APN	5	88,651,158 (GRCm39)	missense	probably benign	0.38
IGL03303:Enam	APN	5	88,652,450 (GRCm39)	missense	probably benign	0.12
opinionated	UTSW	5	88,650,885 (GRCm39)	missense	probably benign	0.04
recalcitrant	UTSW	5	88,651,650 (GRCm39)	nonsense	probably null
R0200:Enam	UTSW	5	88,640,886 (GRCm39)	missense	possibly damaging	0.96
R0230:Enam	UTSW	5	88,637,514 (GRCm39)	splice site	probably benign
R0395:Enam	UTSW	5	88,649,367 (GRCm39)	missense	probably damaging	0.99
R0548:Enam	UTSW	5	88,650,964 (GRCm39)	missense	probably damaging	0.96
R0608:Enam	UTSW	5	88,640,886 (GRCm39)	missense	possibly damaging	0.96
R0724:Enam	UTSW	5	88,649,853 (GRCm39)	missense	probably damaging	1.00
R0927:Enam	UTSW	5	88,641,919 (GRCm39)	missense	possibly damaging	0.72
R1023:Enam	UTSW	5	88,649,826 (GRCm39)	missense	probably damaging	0.99
R1053:Enam	UTSW	5	88,651,878 (GRCm39)	missense	possibly damaging	0.64
R1169:Enam	UTSW	5	88,651,117 (GRCm39)	missense	probably damaging	1.00
R1230:Enam	UTSW	5	88,641,927 (GRCm39)	missense	probably damaging	0.99
R1324:Enam	UTSW	5	88,641,927 (GRCm39)	missense	possibly damaging	0.53
R1663:Enam	UTSW	5	88,651,853 (GRCm39)	missense	probably damaging	1.00
R1727:Enam	UTSW	5	88,651,853 (GRCm39)	missense	probably damaging	1.00
R1750:Enam	UTSW	5	88,651,086 (GRCm39)	missense	probably damaging	1.00
R1852:Enam	UTSW	5	88,652,324 (GRCm39)	missense	possibly damaging	0.92
R1907:Enam	UTSW	5	88,652,481 (GRCm39)	missense	possibly damaging	0.86
R2104:Enam	UTSW	5	88,649,646 (GRCm39)	missense	probably damaging	1.00
R2143:Enam	UTSW	5	88,640,779 (GRCm39)	missense	probably benign	0.02
R2196:Enam	UTSW	5	88,650,603 (GRCm39)	missense	probably damaging	0.99
R2363:Enam	UTSW	5	88,651,008 (GRCm39)	missense	probably benign	0.24
R2497:Enam	UTSW	5	88,650,553 (GRCm39)	missense	probably benign	0.13
R3615:Enam	UTSW	5	88,652,306 (GRCm39)	missense	possibly damaging	0.81
R3616:Enam	UTSW	5	88,652,306 (GRCm39)	missense	possibly damaging	0.81
R3782:Enam	UTSW	5	88,650,674 (GRCm39)	missense	probably damaging	1.00
R4067:Enam	UTSW	5	88,651,236 (GRCm39)	missense	probably damaging	1.00
R4349:Enam	UTSW	5	88,651,407 (GRCm39)	missense	probably damaging	0.99
R4604:Enam	UTSW	5	88,652,142 (GRCm39)	missense	possibly damaging	0.93
R4649:Enam	UTSW	5	88,640,827 (GRCm39)	missense	probably benign	0.02
R4702:Enam	UTSW	5	88,651,650 (GRCm39)	nonsense	probably null
R4703:Enam	UTSW	5	88,651,650 (GRCm39)	nonsense	probably null
R4704:Enam	UTSW	5	88,651,650 (GRCm39)	nonsense	probably null
R4705:Enam	UTSW	5	88,651,650 (GRCm39)	nonsense	probably null
R4714:Enam	UTSW	5	88,651,395 (GRCm39)	missense	probably damaging	1.00
R4748:Enam	UTSW	5	88,649,402 (GRCm39)	missense	probably damaging	1.00
R4838:Enam	UTSW	5	88,640,967 (GRCm39)	nonsense	probably null
R4840:Enam	UTSW	5	88,650,885 (GRCm39)	missense	probably benign	0.04
R4856:Enam	UTSW	5	88,636,593 (GRCm39)	nonsense	probably null
R4886:Enam	UTSW	5	88,636,593 (GRCm39)	nonsense	probably null
R4910:Enam	UTSW	5	88,650,173 (GRCm39)	missense	probably benign
R4911:Enam	UTSW	5	88,650,173 (GRCm39)	missense	probably benign
R6103:Enam	UTSW	5	88,650,187 (GRCm39)	missense	probably damaging	0.96
R6651:Enam	UTSW	5	88,650,776 (GRCm39)	missense	probably damaging	0.98
R6759:Enam	UTSW	5	88,649,550 (GRCm39)	missense	probably damaging	1.00
R7282:Enam	UTSW	5	88,650,186 (GRCm39)	missense	probably damaging	0.99
R7365:Enam	UTSW	5	88,649,347 (GRCm39)	missense	possibly damaging	0.75
R7392:Enam	UTSW	5	88,649,523 (GRCm39)	missense	probably damaging	0.99
R7483:Enam	UTSW	5	88,649,679 (GRCm39)	missense	probably damaging	1.00
R7647:Enam	UTSW	5	88,650,884 (GRCm39)	missense	probably benign	0.00
R7648:Enam	UTSW	5	88,652,016 (GRCm39)	missense	possibly damaging	0.89
R7672:Enam	UTSW	5	88,651,830 (GRCm39)	missense	possibly damaging	0.80
R7943:Enam	UTSW	5	88,636,410 (GRCm39)	splice site	probably null
R7999:Enam	UTSW	5	88,651,561 (GRCm39)	missense	probably benign
R8117:Enam	UTSW	5	88,651,385 (GRCm39)	missense	probably benign	0.00
R8419:Enam	UTSW	5	88,651,209 (GRCm39)	missense	possibly damaging	0.80
R8836:Enam	UTSW	5	88,639,124 (GRCm39)	critical splice donor site	probably null
R8973:Enam	UTSW	5	88,641,947 (GRCm39)	missense	possibly damaging	0.96
R9001:Enam	UTSW	5	88,637,388 (GRCm39)	missense	probably benign	0.11
R9033:Enam	UTSW	5	88,646,475 (GRCm39)	missense	probably benign	0.01
R9268:Enam	UTSW	5	88,640,778 (GRCm39)	missense	probably benign	0.01
R9723:Enam	UTSW	5	88,652,241 (GRCm39)	missense	probably damaging	1.00
X0018:Enam	UTSW	5	88,650,550 (GRCm39)	nonsense	probably null
Z1176:Enam	UTSW	5	88,640,830 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTCCGGGGTTAATTATGCAGG -3'
(R):5'- CCACAAAGGGTTTATTTGCACC -3'

Sequencing Primer
(F):5'- TGCAGGAAATCCAGTCCATTTCG -3'
(R):5'- AGGGTTTATTTGCACCTACATTG -3'

Posted On

2021-01-18