Incidental Mutation 'R8528:Zfp442'
ID 658888
Institutional Source Beutler Lab
Gene Symbol Zfp442
Ensembl Gene ENSMUSG00000068130
Gene Name zinc finger protein 442
Synonyms OTTMUSG00000015730
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8528 (G1)
Quality Score 131.008
Status Not validated
Chromosome 2
Chromosomal Location 150407141-150451486 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 150409042 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 312 (H312Q)
Ref Sequence ENSEMBL: ENSMUSP00000140098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109916] [ENSMUST00000185796]
AlphaFold A2AQA0
Predicted Effect possibly damaging
Transcript: ENSMUST00000109916
AA Change: H313Q

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105542
Gene: ENSMUSG00000068130
AA Change: H313Q

DomainStartEndE-ValueType
KRAB 4 66 3.27e-19 SMART
ZnF_C2H2 159 181 8.34e-3 SMART
ZnF_C2H2 211 233 9.58e-3 SMART
ZnF_C2H2 239 261 2.43e-4 SMART
ZnF_C2H2 267 289 1.38e-3 SMART
ZnF_C2H2 295 317 4.17e-3 SMART
ZnF_C2H2 323 345 3.16e-3 SMART
ZnF_C2H2 351 373 1.58e-3 SMART
ZnF_C2H2 379 401 9.58e-3 SMART
ZnF_C2H2 407 429 2.09e-3 SMART
ZnF_C2H2 435 457 2.2e-2 SMART
ZnF_C2H2 463 485 1.6e-4 SMART
ZnF_C2H2 491 513 1.82e-3 SMART
ZnF_C2H2 519 541 4.47e-3 SMART
ZnF_C2H2 547 569 3.63e-3 SMART
ZnF_C2H2 575 597 4.79e-3 SMART
ZnF_C2H2 603 625 8.47e-4 SMART
ZnF_C2H2 631 654 3.11e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185796
AA Change: H312Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140098
Gene: ENSMUSG00000068130
AA Change: H312Q

DomainStartEndE-ValueType
KRAB 3 65 1.4e-21 SMART
ZnF_C2H2 158 180 3.4e-5 SMART
ZnF_C2H2 210 232 3.9e-5 SMART
ZnF_C2H2 238 260 1e-6 SMART
ZnF_C2H2 266 288 5.6e-6 SMART
ZnF_C2H2 294 316 1.8e-5 SMART
ZnF_C2H2 322 344 1.3e-5 SMART
ZnF_C2H2 350 372 6.7e-6 SMART
ZnF_C2H2 378 400 9.6e-5 SMART
ZnF_C2H2 406 428 6.9e-7 SMART
ZnF_C2H2 434 456 7.7e-6 SMART
ZnF_C2H2 462 484 1.9e-5 SMART
ZnF_C2H2 490 512 1.5e-5 SMART
ZnF_C2H2 518 540 2e-5 SMART
ZnF_C2H2 546 568 3.5e-6 SMART
ZnF_C2H2 574 597 1.3e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A C 15: 74,575,851 I169L possibly damaging Het
Ahnak A T 19: 9,007,728 K2125N probably damaging Het
Arl5b T A 2: 15,073,327 probably null Het
BC055324 T C 1: 163,986,083 K191E probably damaging Het
Ccng2 T C 5: 93,269,305 V60A possibly damaging Het
Cfap65 A G 1: 74,905,937 V1442A possibly damaging Het
Cyp1b1 T A 17: 79,710,564 E387D probably damaging Het
Dchs2 T C 3: 83,354,611 S2729P probably damaging Het
Dnah11 A G 12: 118,008,803 F2882S probably damaging Het
Dpy30 T C 17: 74,299,762 D97G probably benign Het
Enam T A 5: 88,502,219 V454E probably damaging Het
Eppk1 C T 15: 76,110,119 R854Q probably benign Het
Ero1lb T A 13: 12,599,868 C240* probably null Het
Exog A G 9: 119,462,620 D297G probably damaging Het
Fbxl12 C A 9: 20,638,864 R165L possibly damaging Het
Fer1l5 A G 1: 36,417,774 Y1611C possibly damaging Het
Frmpd1 T C 4: 45,285,034 V1285A probably benign Het
Gfpt1 G C 6: 87,066,788 probably null Het
Gm15446 T C 5: 109,943,030 Y383H possibly damaging Het
Gsdmc A T 15: 63,777,340 probably null Het
Hao1 A G 2: 134,522,993 I238T probably damaging Het
Kcnq5 G A 1: 21,479,424 R360C probably damaging Het
Kcnv2 T A 19: 27,322,987 D79E probably benign Het
Lrrc8a T C 2: 30,255,545 Y124H probably damaging Het
Lrrc8d T A 5: 105,812,486 M254K probably benign Het
Map3k4 T C 17: 12,232,934 N1489S probably damaging Het
Mapk8ip2 A G 15: 89,455,219 D34G probably damaging Het
Myo9a A G 9: 59,860,140 T876A probably damaging Het
Pabpc2 C T 18: 39,775,386 T568I probably benign Het
Pcdhga2 G T 18: 37,669,168 A22S probably benign Het
Rc3h2 G A 2: 37,382,799 T755I probably benign Het
Sertad4 A G 1: 192,851,083 V15A probably benign Het
Slc28a2 A G 2: 122,455,742 K520E probably damaging Het
Slc4a10 T C 2: 62,296,796 V831A possibly damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Spag17 A T 3: 100,124,185 I2255F possibly damaging Het
Sprn C T 7: 140,153,510 probably benign Het
Stim1 T C 7: 102,431,082 probably benign Het
Stk24 C A 14: 121,292,035 A402S probably benign Het
Sycp2 A G 2: 178,374,533 L712P probably damaging Het
Tenm3 C T 8: 48,342,633 G269S probably damaging Het
Zdbf2 A G 1: 63,303,386 E308G possibly damaging Het
Other mutations in Zfp442
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Zfp442 APN 2 150409347 nonsense probably null
IGL02566:Zfp442 APN 2 150409791 critical splice acceptor site probably null
IGL03217:Zfp442 APN 2 150409794 splice site probably benign
LCD18:Zfp442 UTSW 2 150419848 intron probably benign
PIT4812001:Zfp442 UTSW 2 150409741 nonsense probably null
R0219:Zfp442 UTSW 2 150411240 missense probably damaging 0.99
R0521:Zfp442 UTSW 2 150411249 missense possibly damaging 0.92
R1633:Zfp442 UTSW 2 150408340 nonsense probably null
R1702:Zfp442 UTSW 2 150409180 nonsense probably null
R1829:Zfp442 UTSW 2 150409063 missense probably damaging 0.99
R1868:Zfp442 UTSW 2 150408180 missense probably damaging 1.00
R1898:Zfp442 UTSW 2 150408662 missense probably damaging 1.00
R2030:Zfp442 UTSW 2 150408122 missense possibly damaging 0.58
R4676:Zfp442 UTSW 2 150409606 missense probably damaging 1.00
R4717:Zfp442 UTSW 2 150408229 missense probably damaging 1.00
R4894:Zfp442 UTSW 2 150411210 critical splice donor site probably null
R4932:Zfp442 UTSW 2 150409715 missense possibly damaging 0.53
R4963:Zfp442 UTSW 2 150408495 missense probably damaging 1.00
R5130:Zfp442 UTSW 2 150409610 missense possibly damaging 0.91
R5476:Zfp442 UTSW 2 150408159 missense probably damaging 1.00
R5986:Zfp442 UTSW 2 150408024 nonsense probably null
R6042:Zfp442 UTSW 2 150408096 missense probably damaging 0.97
R6383:Zfp442 UTSW 2 150451401 critical splice donor site probably null
R6452:Zfp442 UTSW 2 150408108 missense probably damaging 1.00
R6787:Zfp442 UTSW 2 150409579 missense possibly damaging 0.72
R6931:Zfp442 UTSW 2 150410940 critical splice donor site probably null
R7061:Zfp442 UTSW 2 150408017 missense probably benign 0.33
R7184:Zfp442 UTSW 2 150408136 missense possibly damaging 0.71
R7214:Zfp442 UTSW 2 150409281 missense probably benign 0.04
R7225:Zfp442 UTSW 2 150409005 missense probably benign 0.00
R7513:Zfp442 UTSW 2 150408756 missense unknown
R7591:Zfp442 UTSW 2 150408172 nonsense probably null
R7679:Zfp442 UTSW 2 150410997 nonsense probably null
R7768:Zfp442 UTSW 2 150408321 missense possibly damaging 0.53
R7801:Zfp442 UTSW 2 150409719 missense probably benign 0.28
R7814:Zfp442 UTSW 2 150409482 missense possibly damaging 0.92
R7848:Zfp442 UTSW 2 150411226 missense possibly damaging 0.71
R8158:Zfp442 UTSW 2 150409176 missense possibly damaging 0.83
R8192:Zfp442 UTSW 2 150408709 missense unknown
R9110:Zfp442 UTSW 2 150408173 missense probably benign 0.30
R9269:Zfp442 UTSW 2 150409367 missense probably benign 0.19
R9371:Zfp442 UTSW 2 150408756 missense unknown
R9401:Zfp442 UTSW 2 150409695 missense possibly damaging 0.53
R9459:Zfp442 UTSW 2 150408748 missense unknown
R9711:Zfp442 UTSW 2 150408287 missense possibly damaging 0.93
Z1177:Zfp442 UTSW 2 150408479 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTATCACACTGGTCACATCCAA -3'
(R):5'- CCAATGTGGTAAAGCCTTTTCACA -3'

Sequencing Primer
(F):5'- ACTGGTCACATCCAAAGGGTTTC -3'
(R):5'- GTGGTAAAGCCTTTTCACAAAACAGC -3'
Posted On 2021-01-18