Mutagenetix > Incidental Mutation

Incidental Mutation 'R8552:Rad54l2'

659913

Institutional Source

Beutler Lab

Gene Symbol

Rad54l2

Ensembl Gene

ENSMUSG00000040661

Gene Name

RAD54 like 2 (S. cerevisiae)

Synonyms

Srisnf2l, G630026H09Rik, Arip4

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8552 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

106688082-106789194 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 106693578 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 1181 (Q1181L)

Ref Sequence

ENSEMBL: ENSMUSP00000045454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046502]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000046502
AA Change: Q1181L

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000045454
Gene: ENSMUSG00000040661
AA Change: Q1181L

Domain	Start	End	E-Value	Type
coiled coil region	20	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	130	146	N/A	INTRINSIC
low complexity region	186	200	N/A	INTRINSIC
low complexity region	215	229	N/A	INTRINSIC
DEXDc	267	520	4.21e-20	SMART
HELICc	751	854	1.88e-17	SMART
low complexity region	959	976	N/A	INTRINSIC
low complexity region	1348	1368	N/A	INTRINSIC
low complexity region	1453	1460	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000189553

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null embryos show delayed growth, reduced cell proliferation, increased apoptosis and die by E11.5. At E9.5-E10.5, most major organs are smaller and the neural tube is shrunk in some cases. Mutant MEFs cease to grow after 2-3 passages showing increased apoptosis and reduced DNA synthesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg2	A	G	6: 58,669,225	H242R	possibly damaging	Het
Adam1b	G	T	5: 121,501,441	R514S	probably benign	Het
Adprhl2	A	G	4: 126,316,575	*371Q	probably null	Het
Arid4a	T	C	12: 71,060,075	L307P	probably benign	Het
Armc12	C	T	17: 28,538,701	A269V	probably benign	Het
Asb1	T	A	1: 91,552,356	V259E	probably damaging	Het
Atm	T	C	9: 53,524,497	Y171C	probably damaging	Het
Atp8a2	A	T	14: 59,773,982	F959L	probably benign	Het
B4galt3	G	T	1: 171,274,347	E34D	possibly damaging	Het
Cacna1i	A	G	15: 80,320,397	N90S	possibly damaging	Het
Cdc42ep2	T	A	19: 5,918,032	*215L	probably null	Het
Cep162	C	T	9: 87,244,308	E184K	probably benign	Het
Cnga3	C	T	1: 37,244,979	P121L	probably benign	Het
Cpt1b	G	A	15: 89,422,321	R285C	probably damaging	Het
Defb18	T	C	1: 18,236,567	Y55C	probably damaging	Het
Depdc1b	C	T	13: 108,357,425	P116S	probably damaging	Het
Dhx16	C	T	17: 35,881,291	A74V	possibly damaging	Het
Dnajc21	A	T	15: 10,463,919	Y53*	probably null	Het
Dse	T	C	10: 34,152,320	R925G	possibly damaging	Het
Dsp	C	T	13: 38,185,141	L738F	probably damaging	Het
Erv3	T	C	2: 131,856,341	K33E	possibly damaging	Het
Gas2l2	T	A	11: 83,422,081	T802S	probably benign	Het
Gdf9	T	C	11: 53,433,551	L49S	possibly damaging	Het
Gigyf1	G	T	5: 137,523,139		probably benign	Het
Gm4792	T	A	10: 94,295,199	I83L	unknown	Het
Ighv9-3	A	G	12: 114,140,729	L105P	probably damaging	Het
Krtap5-1	C	A	7: 142,296,423	W189L	probably null	Het
Krtap5-3	T	A	7: 142,202,352		probably benign	Het
Lrp1b	T	A	2: 41,408,981	E108D	probably benign	Het
Lrrc66	G	A	5: 73,610,885	P238S	probably benign	Het
Ms4a4c	C	T	19: 11,414,832	Q6*	probably null	Het
Olfr1447	A	G	19: 12,901,732	L16P	probably damaging	Het
Olfr214	G	T	6: 116,557,328	R301L	probably damaging	Het
Peg10	GC	GCTCC	6: 4,756,452		probably benign	Het
Pinx1	A	G	14: 63,919,523	R300G	probably benign	Het
Pkd1	T	A	17: 24,591,469	H92Q	probably damaging	Het
Rbl1	A	T	2: 157,196,254	V131E	probably damaging	Het
Rbp3	A	G	14: 33,955,664	E523G	probably benign	Het
Rftn1	G	T	17: 50,047,380	A318D	probably damaging	Het
Slc22a20	C	A	19: 5,985,670	C130F	probably damaging	Het
Smcr8	T	C	11: 60,780,153	L709S	probably damaging	Het
Spef2	A	G	15: 9,600,679		probably benign	Het
Teddm1b	T	A	1: 153,874,448	M1K	probably null	Het
Tes	A	G	6: 17,097,328	Y60C	probably damaging	Het
Tmem104	T	C	11: 115,197,318	L43P	probably damaging	Het
Tnfaip3	T	C	10: 19,004,465	E618G	probably damaging	Het
Tnfaip3	T	C	10: 19,004,666	D551G	probably damaging	Het
Tnrc6a	CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT	CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT	7: 123,162,446		probably benign	Het
Trim30b	T	A	7: 104,366,029	T51S	probably benign	Het
Trmt44	G	T	5: 35,565,400	H441Q	probably benign	Het
Tshr	C	A	12: 91,537,285	D332E	probably benign	Het
Usp10	C	T	8: 119,956,628	T746M	possibly damaging	Het
Vmn1r8	A	T	6: 57,036,153	D63V	possibly damaging	Het
Vps13a	A	C	19: 16,754,320	L143V	probably damaging	Het
Wnt3a	T	A	11: 59,275,217	H79L	probably damaging	Het
Zbtb7a	C	T	10: 81,144,307	R112W	probably damaging	Het

Other mutations in Rad54l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Rad54l2	APN	9	106700561	missense	probably benign
IGL00718:Rad54l2	APN	9	106713455	missense	probably damaging	1.00
IGL00917:Rad54l2	APN	9	106710439	missense	possibly damaging	0.95
IGL01319:Rad54l2	APN	9	106719046	missense	probably benign	0.18
IGL01447:Rad54l2	APN	9	106702772	missense	probably damaging	1.00
IGL01469:Rad54l2	APN	9	106722758	missense	probably damaging	1.00
IGL01836:Rad54l2	APN	9	106716157	missense	probably benign	0.00
IGL02017:Rad54l2	APN	9	106754040	missense	possibly damaging	0.85
IGL02179:Rad54l2	APN	9	106720390	missense	probably damaging	1.00
IGL02348:Rad54l2	APN	9	106720376	missense	probably damaging	1.00
IGL02822:Rad54l2	APN	9	106710407	missense	probably damaging	1.00
IGL03169:Rad54l2	APN	9	106719064	missense	probably benign	0.37
IGL03245:Rad54l2	APN	9	106703628	missense	probably damaging	1.00
IGL03253:Rad54l2	APN	9	106704223	missense	probably damaging	1.00
IGL02988:Rad54l2	UTSW	9	106700585	missense	probably benign
PIT4495001:Rad54l2	UTSW	9	106716144	missense	probably benign	0.02
R0001:Rad54l2	UTSW	9	106708217	missense	probably damaging	0.97
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0114:Rad54l2	UTSW	9	106713455	missense	probably damaging	1.00
R0427:Rad54l2	UTSW	9	106693692	missense	possibly damaging	0.65
R0519:Rad54l2	UTSW	9	106708299	missense	probably damaging	0.98
R0760:Rad54l2	UTSW	9	106719606	critical splice donor site	probably null
R1018:Rad54l2	UTSW	9	106712390	missense	probably benign	0.32
R1630:Rad54l2	UTSW	9	106703629	missense	possibly damaging	0.79
R1701:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R1903:Rad54l2	UTSW	9	106693717	splice site	probably null
R2187:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R2205:Rad54l2	UTSW	9	106717798	missense	probably damaging	1.00
R2566:Rad54l2	UTSW	9	106703626	missense	possibly damaging	0.95
R2983:Rad54l2	UTSW	9	106700590	missense	probably benign	0.10
R3176:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3276:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3718:Rad54l2	UTSW	9	106693527	missense	probably benign
R4063:Rad54l2	UTSW	9	106720414	missense	probably benign	0.10
R4206:Rad54l2	UTSW	9	106717795	missense	probably damaging	1.00
R4271:Rad54l2	UTSW	9	106693626	missense	probably benign	0.22
R4377:Rad54l2	UTSW	9	106693222	missense	probably benign	0.00
R4700:Rad54l2	UTSW	9	106754025	missense	possibly damaging	0.85
R4729:Rad54l2	UTSW	9	106716118	missense	probably benign
R4872:Rad54l2	UTSW	9	106717892	missense	probably damaging	1.00
R4997:Rad54l2	UTSW	9	106722909	missense	possibly damaging	0.70
R5475:Rad54l2	UTSW	9	106705858	missense	probably damaging	1.00
R5658:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R6246:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R6248:Rad54l2	UTSW	9	106710338	missense	probably damaging	1.00
R6329:Rad54l2	UTSW	9	106717922	missense	possibly damaging	0.89
R6631:Rad54l2	UTSW	9	106713540	nonsense	probably null
R6773:Rad54l2	UTSW	9	106693317	missense	probably benign
R7148:Rad54l2	UTSW	9	106719119	nonsense	probably null
R7171:Rad54l2	UTSW	9	106713478	missense	probably damaging	1.00
R7226:Rad54l2	UTSW	9	106713472	missense	probably damaging	0.99
R7327:Rad54l2	UTSW	9	106693461	missense	possibly damaging	0.68
R7337:Rad54l2	UTSW	9	106705825	missense	probably damaging	1.00
R7636:Rad54l2	UTSW	9	106720387	missense	probably damaging	1.00
R7659:Rad54l2	UTSW	9	106713578	missense	probably benign	0.11
R7713:Rad54l2	UTSW	9	106717223	missense	probably damaging	1.00
R7748:Rad54l2	UTSW	9	106719034	missense	possibly damaging	0.53
R8021:Rad54l2	UTSW	9	106719641	missense	probably benign	0.00
R8084:Rad54l2	UTSW	9	106713502	missense	possibly damaging	0.63
R8768:Rad54l2	UTSW	9	106719610	missense	probably benign	0.04
R8952:Rad54l2	UTSW	9	106688851	unclassified	probably benign
R8953:Rad54l2	UTSW	9	106693262	missense	probably benign	0.02
R9041:Rad54l2	UTSW	9	106722819	missense	possibly damaging	0.85
R9296:Rad54l2	UTSW	9	106702743	missense	probably damaging	1.00
R9451:Rad54l2	UTSW	9	106708289	missense	probably benign	0.13
R9523:Rad54l2	UTSW	9	106695952	missense	probably damaging	1.00
R9657:Rad54l2	UTSW	9	106704173	missense	probably damaging	0.99
R9757:Rad54l2	UTSW	9	106717921	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTATGGCCCCTTAAGTCCAGC -3'
(R):5'- CAGCAGCGTTGTTATCTCTTG -3'

Sequencing Primer
(F):5'- ACTGGGCTGGCCAGTCAC -3'
(R):5'- AGCGTTGTTATCTCTTGATGCTTC -3'

Posted On

2021-01-18