Incidental Mutation 'R8552:Rad54l2'
ID 659913
Institutional Source Beutler Lab
Gene Symbol Rad54l2
Ensembl Gene ENSMUSG00000040661
Gene Name RAD54 like 2 (S. cerevisiae)
Synonyms Srisnf2l, G630026H09Rik, Arip4
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8552 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 106688082-106789194 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 106693578 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 1181 (Q1181L)
Ref Sequence ENSEMBL: ENSMUSP00000045454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046502]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000046502
AA Change: Q1181L

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000045454
Gene: ENSMUSG00000040661
AA Change: Q1181L

DomainStartEndE-ValueType
coiled coil region 20 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 130 146 N/A INTRINSIC
low complexity region 186 200 N/A INTRINSIC
low complexity region 215 229 N/A INTRINSIC
DEXDc 267 520 4.21e-20 SMART
HELICc 751 854 1.88e-17 SMART
low complexity region 959 976 N/A INTRINSIC
low complexity region 1348 1368 N/A INTRINSIC
low complexity region 1453 1460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189553
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null embryos show delayed growth, reduced cell proliferation, increased apoptosis and die by E11.5. At E9.5-E10.5, most major organs are smaller and the neural tube is shrunk in some cases. Mutant MEFs cease to grow after 2-3 passages showing increased apoptosis and reduced DNA synthesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg2 A G 6: 58,669,225 H242R possibly damaging Het
Adam1b G T 5: 121,501,441 R514S probably benign Het
Adprhl2 A G 4: 126,316,575 *371Q probably null Het
Arid4a T C 12: 71,060,075 L307P probably benign Het
Armc12 C T 17: 28,538,701 A269V probably benign Het
Asb1 T A 1: 91,552,356 V259E probably damaging Het
Atm T C 9: 53,524,497 Y171C probably damaging Het
Atp8a2 A T 14: 59,773,982 F959L probably benign Het
B4galt3 G T 1: 171,274,347 E34D possibly damaging Het
Cacna1i A G 15: 80,320,397 N90S possibly damaging Het
Cdc42ep2 T A 19: 5,918,032 *215L probably null Het
Cep162 C T 9: 87,244,308 E184K probably benign Het
Cnga3 C T 1: 37,244,979 P121L probably benign Het
Cpt1b G A 15: 89,422,321 R285C probably damaging Het
Defb18 T C 1: 18,236,567 Y55C probably damaging Het
Depdc1b C T 13: 108,357,425 P116S probably damaging Het
Dhx16 C T 17: 35,881,291 A74V possibly damaging Het
Dnajc21 A T 15: 10,463,919 Y53* probably null Het
Dse T C 10: 34,152,320 R925G possibly damaging Het
Dsp C T 13: 38,185,141 L738F probably damaging Het
Erv3 T C 2: 131,856,341 K33E possibly damaging Het
Gas2l2 T A 11: 83,422,081 T802S probably benign Het
Gdf9 T C 11: 53,433,551 L49S possibly damaging Het
Gigyf1 G T 5: 137,523,139 probably benign Het
Gm4792 T A 10: 94,295,199 I83L unknown Het
Ighv9-3 A G 12: 114,140,729 L105P probably damaging Het
Krtap5-1 C A 7: 142,296,423 W189L probably null Het
Krtap5-3 T A 7: 142,202,352 probably benign Het
Lrp1b T A 2: 41,408,981 E108D probably benign Het
Lrrc66 G A 5: 73,610,885 P238S probably benign Het
Ms4a4c C T 19: 11,414,832 Q6* probably null Het
Olfr1447 A G 19: 12,901,732 L16P probably damaging Het
Olfr214 G T 6: 116,557,328 R301L probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pinx1 A G 14: 63,919,523 R300G probably benign Het
Pkd1 T A 17: 24,591,469 H92Q probably damaging Het
Rbl1 A T 2: 157,196,254 V131E probably damaging Het
Rbp3 A G 14: 33,955,664 E523G probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Slc22a20 C A 19: 5,985,670 C130F probably damaging Het
Smcr8 T C 11: 60,780,153 L709S probably damaging Het
Spef2 A G 15: 9,600,679 probably benign Het
Teddm1b T A 1: 153,874,448 M1K probably null Het
Tes A G 6: 17,097,328 Y60C probably damaging Het
Tmem104 T C 11: 115,197,318 L43P probably damaging Het
Tnfaip3 T C 10: 19,004,465 E618G probably damaging Het
Tnfaip3 T C 10: 19,004,666 D551G probably damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Trim30b T A 7: 104,366,029 T51S probably benign Het
Trmt44 G T 5: 35,565,400 H441Q probably benign Het
Tshr C A 12: 91,537,285 D332E probably benign Het
Usp10 C T 8: 119,956,628 T746M possibly damaging Het
Vmn1r8 A T 6: 57,036,153 D63V possibly damaging Het
Vps13a A C 19: 16,754,320 L143V probably damaging Het
Wnt3a T A 11: 59,275,217 H79L probably damaging Het
Zbtb7a C T 10: 81,144,307 R112W probably damaging Het
Other mutations in Rad54l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Rad54l2 APN 9 106700561 missense probably benign
IGL00718:Rad54l2 APN 9 106713455 missense probably damaging 1.00
IGL00917:Rad54l2 APN 9 106710439 missense possibly damaging 0.95
IGL01319:Rad54l2 APN 9 106719046 missense probably benign 0.18
IGL01447:Rad54l2 APN 9 106702772 missense probably damaging 1.00
IGL01469:Rad54l2 APN 9 106722758 missense probably damaging 1.00
IGL01836:Rad54l2 APN 9 106716157 missense probably benign 0.00
IGL02017:Rad54l2 APN 9 106754040 missense possibly damaging 0.85
IGL02179:Rad54l2 APN 9 106720390 missense probably damaging 1.00
IGL02348:Rad54l2 APN 9 106720376 missense probably damaging 1.00
IGL02822:Rad54l2 APN 9 106710407 missense probably damaging 1.00
IGL03169:Rad54l2 APN 9 106719064 missense probably benign 0.37
IGL03245:Rad54l2 APN 9 106703628 missense probably damaging 1.00
IGL03253:Rad54l2 APN 9 106704223 missense probably damaging 1.00
IGL02988:Rad54l2 UTSW 9 106700585 missense probably benign
PIT4495001:Rad54l2 UTSW 9 106716144 missense probably benign 0.02
R0001:Rad54l2 UTSW 9 106708217 missense probably damaging 0.97
R0069:Rad54l2 UTSW 9 106710365 missense possibly damaging 0.67
R0069:Rad54l2 UTSW 9 106710365 missense possibly damaging 0.67
R0114:Rad54l2 UTSW 9 106713455 missense probably damaging 1.00
R0427:Rad54l2 UTSW 9 106693692 missense possibly damaging 0.65
R0519:Rad54l2 UTSW 9 106708299 missense probably damaging 0.98
R0760:Rad54l2 UTSW 9 106719606 critical splice donor site probably null
R1018:Rad54l2 UTSW 9 106712390 missense probably benign 0.32
R1630:Rad54l2 UTSW 9 106703629 missense possibly damaging 0.79
R1701:Rad54l2 UTSW 9 106700493 critical splice donor site probably null
R1903:Rad54l2 UTSW 9 106693717 splice site probably null
R2187:Rad54l2 UTSW 9 106753992 small deletion probably benign
R2205:Rad54l2 UTSW 9 106717798 missense probably damaging 1.00
R2566:Rad54l2 UTSW 9 106703626 missense possibly damaging 0.95
R2983:Rad54l2 UTSW 9 106700590 missense probably benign 0.10
R3176:Rad54l2 UTSW 9 106753943 critical splice donor site probably null
R3276:Rad54l2 UTSW 9 106753943 critical splice donor site probably null
R3718:Rad54l2 UTSW 9 106693527 missense probably benign
R4063:Rad54l2 UTSW 9 106720414 missense probably benign 0.10
R4206:Rad54l2 UTSW 9 106717795 missense probably damaging 1.00
R4271:Rad54l2 UTSW 9 106693626 missense probably benign 0.22
R4377:Rad54l2 UTSW 9 106693222 missense probably benign 0.00
R4700:Rad54l2 UTSW 9 106754025 missense possibly damaging 0.85
R4729:Rad54l2 UTSW 9 106716118 missense probably benign
R4872:Rad54l2 UTSW 9 106717892 missense probably damaging 1.00
R4997:Rad54l2 UTSW 9 106722909 missense possibly damaging 0.70
R5475:Rad54l2 UTSW 9 106705858 missense probably damaging 1.00
R5658:Rad54l2 UTSW 9 106753992 small deletion probably benign
R6246:Rad54l2 UTSW 9 106700493 critical splice donor site probably null
R6248:Rad54l2 UTSW 9 106710338 missense probably damaging 1.00
R6329:Rad54l2 UTSW 9 106717922 missense possibly damaging 0.89
R6631:Rad54l2 UTSW 9 106713540 nonsense probably null
R6773:Rad54l2 UTSW 9 106693317 missense probably benign
R7148:Rad54l2 UTSW 9 106719119 nonsense probably null
R7171:Rad54l2 UTSW 9 106713478 missense probably damaging 1.00
R7226:Rad54l2 UTSW 9 106713472 missense probably damaging 0.99
R7327:Rad54l2 UTSW 9 106693461 missense possibly damaging 0.68
R7337:Rad54l2 UTSW 9 106705825 missense probably damaging 1.00
R7636:Rad54l2 UTSW 9 106720387 missense probably damaging 1.00
R7659:Rad54l2 UTSW 9 106713578 missense probably benign 0.11
R7713:Rad54l2 UTSW 9 106717223 missense probably damaging 1.00
R7748:Rad54l2 UTSW 9 106719034 missense possibly damaging 0.53
R8021:Rad54l2 UTSW 9 106719641 missense probably benign 0.00
R8084:Rad54l2 UTSW 9 106713502 missense possibly damaging 0.63
R8768:Rad54l2 UTSW 9 106719610 missense probably benign 0.04
R8952:Rad54l2 UTSW 9 106688851 unclassified probably benign
R8953:Rad54l2 UTSW 9 106693262 missense probably benign 0.02
R9041:Rad54l2 UTSW 9 106722819 missense possibly damaging 0.85
R9296:Rad54l2 UTSW 9 106702743 missense probably damaging 1.00
R9451:Rad54l2 UTSW 9 106708289 missense probably benign 0.13
R9523:Rad54l2 UTSW 9 106695952 missense probably damaging 1.00
R9657:Rad54l2 UTSW 9 106704173 missense probably damaging 0.99
R9757:Rad54l2 UTSW 9 106717921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATGGCCCCTTAAGTCCAGC -3'
(R):5'- CAGCAGCGTTGTTATCTCTTG -3'

Sequencing Primer
(F):5'- ACTGGGCTGGCCAGTCAC -3'
(R):5'- AGCGTTGTTATCTCTTGATGCTTC -3'
Posted On 2021-01-18