Incidental Mutation 'R1701:Rad54l2'
ID189733
Institutional Source Beutler Lab
Gene Symbol Rad54l2
Ensembl Gene ENSMUSG00000040661
Gene NameRAD54 like 2 (S. cerevisiae)
SynonymsSrisnf2l, G630026H09Rik, Arip4
MMRRC Submission 039734-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1701 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location106688082-106789194 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 106700493 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046502]
Predicted Effect probably null
Transcript: ENSMUST00000046502
SMART Domains Protein: ENSMUSP00000045454
Gene: ENSMUSG00000040661

DomainStartEndE-ValueType
coiled coil region 20 49 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 130 146 N/A INTRINSIC
low complexity region 186 200 N/A INTRINSIC
low complexity region 215 229 N/A INTRINSIC
DEXDc 267 520 4.21e-20 SMART
HELICc 751 854 1.88e-17 SMART
low complexity region 959 976 N/A INTRINSIC
low complexity region 1348 1368 N/A INTRINSIC
low complexity region 1453 1460 N/A INTRINSIC
Meta Mutation Damage Score 0.9485 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null embryos show delayed growth, reduced cell proliferation, increased apoptosis and die by E11.5. At E9.5-E10.5, most major organs are smaller and the neural tube is shrunk in some cases. Mutant MEFs cease to grow after 2-3 passages showing increased apoptosis and reduced DNA synthesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl3 A G 4: 144,463,572 L53P probably damaging Het
Acadsb T A 7: 131,424,484 F19I probably benign Het
Aldh3a2 C T 11: 61,256,772 G303S probably damaging Het
Anks1b T C 10: 90,049,954 Y171H probably damaging Het
Anxa7 A T 14: 20,460,161 I385N probably damaging Het
Astn1 A T 1: 158,504,307 T324S possibly damaging Het
Ccdc88a T C 11: 29,477,427 V235A possibly damaging Het
Crhr2 T C 6: 55,099,270 K258R probably damaging Het
Ctnnd1 T C 2: 84,608,991 E786G probably damaging Het
Ctnnd2 G A 15: 30,921,981 D918N probably damaging Het
Dnah9 A G 11: 65,911,924 S200P probably damaging Het
Dot1l T C 10: 80,790,742 S1266P possibly damaging Het
Efemp1 A G 11: 28,921,750 T422A possibly damaging Het
Fam135b T C 15: 71,459,729 H1137R probably damaging Het
Flot2 C T 11: 78,049,547 S40L possibly damaging Het
Fras1 G A 5: 96,600,784 S706N probably benign Het
Gbf1 T C 19: 46,261,675 L357P probably damaging Het
Gm17689 A G 9: 36,581,818 probably benign Het
Gpatch2l A G 12: 86,288,952 S476G probably benign Het
Hbb-bh2 T C 7: 103,840,243 T34A probably benign Het
Ints8 A G 4: 11,231,656 L443P probably damaging Het
Intu T A 3: 40,664,264 D233E probably damaging Het
Kctd1 T A 18: 14,969,560 I259L possibly damaging Het
Lama5 A G 2: 180,221,369 C108R probably damaging Het
Lgals3bp T C 11: 118,393,955 Y266C probably damaging Het
Lrig2 T C 3: 104,494,677 I111V probably benign Het
Myh8 G T 11: 67,280,138 C125F probably damaging Het
Olfr1140 T A 2: 87,746,550 M118K probably damaging Het
Olfr203 T C 16: 59,303,288 I46T probably benign Het
Olfr502 T G 7: 108,523,524 Q142P probably benign Het
Olfr642 T C 7: 104,050,195 E53G possibly damaging Het
Olfr709-ps1 C A 7: 106,926,922 C179F probably damaging Het
Olfr771 T C 10: 129,160,105 Q293R probably damaging Het
Olfr90 C T 17: 37,085,731 V145M probably benign Het
Olfr967 A T 9: 39,751,069 I228F probably damaging Het
Phc2 C T 4: 128,751,607 P836S probably damaging Het
Pla2g7 T C 17: 43,600,524 F189S probably damaging Het
Ptprk A G 10: 28,466,058 D487G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Robo4 G T 9: 37,403,443 V198L probably benign Het
Selenbp1 C A 3: 94,937,390 H119Q probably damaging Het
Slc25a13 T C 6: 6,152,525 probably null Het
Slc35f5 A G 1: 125,570,593 E176G possibly damaging Het
Soga1 T C 2: 157,030,619 N936S probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 A G 2: 79,636,050 K75E probably damaging Het
Tenm4 G A 7: 96,902,889 V2512M probably damaging Het
Tmc8 A G 11: 117,791,362 probably null Het
Trim30d C T 7: 104,484,182 W21* probably null Het
Ube3c G A 5: 29,601,202 V281I probably benign Het
Usp17ld T C 7: 103,250,576 K383R probably benign Het
Vmn1r172 A T 7: 23,660,104 Y138F probably damaging Het
Vmn1r180 T C 7: 23,952,970 V186A possibly damaging Het
Vmn2r25 T A 6: 123,851,795 probably null Het
Vmn2r61 T C 7: 42,300,511 F785S probably damaging Het
Zfp141 T A 7: 42,476,046 Y334F probably benign Het
Zfp609 T C 9: 65,731,000 I317V probably benign Het
Zfp879 A G 11: 50,833,233 I259T possibly damaging Het
Other mutations in Rad54l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Rad54l2 APN 9 106700561 missense probably benign
IGL00718:Rad54l2 APN 9 106713455 missense probably damaging 1.00
IGL00917:Rad54l2 APN 9 106710439 missense possibly damaging 0.95
IGL01319:Rad54l2 APN 9 106719046 missense probably benign 0.18
IGL01447:Rad54l2 APN 9 106702772 missense probably damaging 1.00
IGL01469:Rad54l2 APN 9 106722758 missense probably damaging 1.00
IGL01836:Rad54l2 APN 9 106716157 missense probably benign 0.00
IGL02017:Rad54l2 APN 9 106754040 missense possibly damaging 0.85
IGL02179:Rad54l2 APN 9 106720390 missense probably damaging 1.00
IGL02348:Rad54l2 APN 9 106720376 missense probably damaging 1.00
IGL02822:Rad54l2 APN 9 106710407 missense probably damaging 1.00
IGL03169:Rad54l2 APN 9 106719064 missense probably benign 0.37
IGL03245:Rad54l2 APN 9 106703628 missense probably damaging 1.00
IGL03253:Rad54l2 APN 9 106704223 missense probably damaging 1.00
IGL02988:Rad54l2 UTSW 9 106700585 missense probably benign
PIT4495001:Rad54l2 UTSW 9 106716144 missense probably benign 0.02
R0001:Rad54l2 UTSW 9 106708217 missense probably damaging 0.97
R0069:Rad54l2 UTSW 9 106710365 missense possibly damaging 0.67
R0069:Rad54l2 UTSW 9 106710365 missense possibly damaging 0.67
R0114:Rad54l2 UTSW 9 106713455 missense probably damaging 1.00
R0427:Rad54l2 UTSW 9 106693692 missense possibly damaging 0.65
R0519:Rad54l2 UTSW 9 106708299 missense probably damaging 0.98
R0760:Rad54l2 UTSW 9 106719606 critical splice donor site probably null
R1018:Rad54l2 UTSW 9 106712390 missense probably benign 0.32
R1630:Rad54l2 UTSW 9 106703629 missense possibly damaging 0.79
R1903:Rad54l2 UTSW 9 106693717 unclassified probably null
R2187:Rad54l2 UTSW 9 106753992 small deletion probably benign
R2205:Rad54l2 UTSW 9 106717798 missense probably damaging 1.00
R2566:Rad54l2 UTSW 9 106703626 missense possibly damaging 0.95
R2983:Rad54l2 UTSW 9 106700590 missense probably benign 0.10
R3176:Rad54l2 UTSW 9 106753943 critical splice donor site probably null
R3276:Rad54l2 UTSW 9 106753943 critical splice donor site probably null
R3718:Rad54l2 UTSW 9 106693527 missense probably benign
R4063:Rad54l2 UTSW 9 106720414 missense probably benign 0.10
R4206:Rad54l2 UTSW 9 106717795 missense probably damaging 1.00
R4271:Rad54l2 UTSW 9 106693626 missense probably benign 0.22
R4377:Rad54l2 UTSW 9 106693222 missense probably benign 0.00
R4700:Rad54l2 UTSW 9 106754025 missense possibly damaging 0.85
R4729:Rad54l2 UTSW 9 106716118 missense probably benign
R4872:Rad54l2 UTSW 9 106717892 missense probably damaging 1.00
R4997:Rad54l2 UTSW 9 106722909 missense possibly damaging 0.70
R5475:Rad54l2 UTSW 9 106705858 missense probably damaging 1.00
R5658:Rad54l2 UTSW 9 106753992 small deletion probably benign
R6246:Rad54l2 UTSW 9 106700493 critical splice donor site probably null
R6248:Rad54l2 UTSW 9 106710338 missense probably damaging 1.00
R6329:Rad54l2 UTSW 9 106717922 missense possibly damaging 0.89
R6631:Rad54l2 UTSW 9 106713540 nonsense probably null
R6773:Rad54l2 UTSW 9 106693317 missense probably benign
R7148:Rad54l2 UTSW 9 106719119 nonsense probably null
R7171:Rad54l2 UTSW 9 106713478 missense probably damaging 1.00
R7226:Rad54l2 UTSW 9 106713472 missense probably damaging 0.99
R7327:Rad54l2 UTSW 9 106693461 missense possibly damaging 0.68
R7337:Rad54l2 UTSW 9 106705825 missense probably damaging 1.00
R7636:Rad54l2 UTSW 9 106720387 missense probably damaging 1.00
R7659:Rad54l2 UTSW 9 106713578 missense probably benign 0.11
R7713:Rad54l2 UTSW 9 106717223 missense probably damaging 1.00
R7748:Rad54l2 UTSW 9 106719034 missense possibly damaging 0.53
R8021:Rad54l2 UTSW 9 106719641 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ggaacatatgAACACTGGTACACACATGA -3'
(R):5'- CAGCCAACACTGAAGGGTGATGAA -3'

Sequencing Primer
(F):5'- agaaaggaagggagggagg -3'
(R):5'- CTGAAGGGTGATGAAAAGCCTG -3'
Posted On2014-05-14