Mutagenetix > Incidental Mutation

Incidental Mutation 'R1630:Rad54l2'

172744

Institutional Source

Beutler Lab

Gene Symbol

Rad54l2

Ensembl Gene

ENSMUSG00000040661

Gene Name

RAD54 like 2 (S. cerevisiae)

Synonyms

Srisnf2l, G630026H09Rik, Arip4

MMRRC Submission

039667-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1630 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106688082-106789194 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 106703629 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 898 (F898L)

Ref Sequence

ENSEMBL: ENSMUSP00000045454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046502]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000046502
AA Change: F898L

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000045454
Gene: ENSMUSG00000040661
AA Change: F898L

Domain	Start	End	E-Value	Type
coiled coil region	20	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	130	146	N/A	INTRINSIC
low complexity region	186	200	N/A	INTRINSIC
low complexity region	215	229	N/A	INTRINSIC
DEXDc	267	520	4.21e-20	SMART
HELICc	751	854	1.88e-17	SMART
low complexity region	959	976	N/A	INTRINSIC
low complexity region	1348	1368	N/A	INTRINSIC
low complexity region	1453	1460	N/A	INTRINSIC

Meta Mutation Damage Score

0.0798

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.1%

Validation Efficiency

100% (67/67)

MGI Phenotype

PHENOTYPE: Homozygous null embryos show delayed growth, reduced cell proliferation, increased apoptosis and die by E11.5. At E9.5-E10.5, most major organs are smaller and the neural tube is shrunk in some cases. Mutant MEFs cease to grow after 2-3 passages showing increased apoptosis and reduced DNA synthesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931429P17Rik	C	A	13: 47,960,725		noncoding transcript	Het
9930012K11Rik	T	C	14: 70,157,180	E175G	probably benign	Het
A630091E08Rik	A	G	7: 98,543,607		noncoding transcript	Het
Atm	A	T	9: 53,479,673	L1867Q	probably damaging	Het
Atp5a1	A	G	18: 77,777,567	D63G	possibly damaging	Het
Baz2b	A	T	2: 60,006,130	S20T	unknown	Het
C1qtnf7	G	A	5: 43,609,161	C34Y	possibly damaging	Het
Cactin	A	G	10: 81,323,725	T353A	probably benign	Het
Cdyl	A	G	13: 35,683,803	K21E	possibly damaging	Het
Crispld1	A	G	1: 17,728,798	T48A	probably benign	Het
Csmd3	T	A	15: 47,838,522	T1722S	possibly damaging	Het
Dapk1	A	T	13: 60,729,531	E528V	probably damaging	Het
Dennd4a	A	G	9: 64,871,882	D549G	probably benign	Het
Dnajc5b	C	A	3: 19,574,741	N66K	probably damaging	Het
Dusp16	G	T	6: 134,720,561	R250S	probably damaging	Het
F10	A	G	8: 13,055,551	N384S	probably benign	Het
Gabrr2	A	G	4: 33,085,647	S331G	probably damaging	Het
Gm12185	A	C	11: 48,907,890	I592S	probably benign	Het
Gm9755	T	C	8: 67,514,660		noncoding transcript	Het
Hspg2	T	C	4: 137,518,435	L913P	probably damaging	Het
Ifna1	T	A	4: 88,850,329	S81R	probably benign	Het
Iqgap2	T	C	13: 95,689,785	K510E	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lhx6	A	G	2: 36,102,901	Y140H	probably damaging	Het
Lix1	A	G	17: 17,457,158	H205R	probably damaging	Het
Masp2	A	T	4: 148,614,033	T524S	probably benign	Het
Mndal	A	C	1: 173,874,392	F115V	possibly damaging	Het
Morc3	C	A	16: 93,866,533	N541K	probably benign	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Myocd	A	G	11: 65,196,394	S236P	probably benign	Het
Nes	T	A	3: 87,977,677	V1037E	probably benign	Het
Nfkbil1	A	G	17: 35,221,164	W178R	probably damaging	Het
Nobox	A	T	6: 43,307,212	C8*	probably null	Het
Nwd1	A	G	8: 72,667,029	T348A	possibly damaging	Het
Olfr1048	A	G	2: 86,236,086	S243P	probably damaging	Het
Olfr1350	T	C	7: 6,570,674	S228P	probably damaging	Het
Olfr382	T	C	11: 73,516,720	T160A	probably damaging	Het
Osbp2	T	C	11: 3,717,167	T448A	probably benign	Het
Plrg1	A	G	3: 83,058,763	D75G	probably benign	Het
Ppp1r8	T	C	4: 132,829,437	E213G	probably benign	Het
Rapgef6	TG	TGG	11: 54,546,397		probably null	Het
Rasl10a	G	C	11: 5,059,542	R110P	probably damaging	Het
Rttn	T	C	18: 89,042,954	I1082T	probably benign	Het
Sema6d	A	G	2: 124,664,345	D734G	possibly damaging	Het
Sgce	C	T	6: 4,719,476	V44M	probably damaging	Het
Sgo2b	A	G	8: 63,927,797	V667A	possibly damaging	Het
Shcbp1	A	T	8: 4,748,763	C118*	probably null	Het
Slain2	C	T	5: 72,976,004	P563S	probably damaging	Het
Slco1b2	A	T	6: 141,656,821	I167F	probably damaging	Het
Speg	T	C	1: 75,422,977	L2356P	probably damaging	Het
Sptbn4	A	G	7: 27,418,739	V305A	probably benign	Het
Sspo	G	A	6: 48,457,724	R1050H	probably benign	Het
Tmem106b	A	G	6: 13,081,541	N149S	probably benign	Het
Tmem200a	T	C	10: 25,992,914	T486A	probably damaging	Het
Tmem212	T	A	3: 27,885,101	T79S	possibly damaging	Het
Ttll11	A	G	2: 35,889,325	V471A	probably damaging	Het
Vill	A	G	9: 119,070,701	N318D	probably benign	Het
Vmn2r102	A	G	17: 19,678,770	D458G	possibly damaging	Het
Zfp472	T	A	17: 32,977,978	C342*	probably null	Het
Zfp963	A	T	8: 69,744,187		probably benign	Het

Other mutations in Rad54l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Rad54l2	APN	9	106700561	missense	probably benign
IGL00718:Rad54l2	APN	9	106713455	missense	probably damaging	1.00
IGL00917:Rad54l2	APN	9	106710439	missense	possibly damaging	0.95
IGL01319:Rad54l2	APN	9	106719046	missense	probably benign	0.18
IGL01447:Rad54l2	APN	9	106702772	missense	probably damaging	1.00
IGL01469:Rad54l2	APN	9	106722758	missense	probably damaging	1.00
IGL01836:Rad54l2	APN	9	106716157	missense	probably benign	0.00
IGL02017:Rad54l2	APN	9	106754040	missense	possibly damaging	0.85
IGL02179:Rad54l2	APN	9	106720390	missense	probably damaging	1.00
IGL02348:Rad54l2	APN	9	106720376	missense	probably damaging	1.00
IGL02822:Rad54l2	APN	9	106710407	missense	probably damaging	1.00
IGL03169:Rad54l2	APN	9	106719064	missense	probably benign	0.37
IGL03245:Rad54l2	APN	9	106703628	missense	probably damaging	1.00
IGL03253:Rad54l2	APN	9	106704223	missense	probably damaging	1.00
IGL02988:Rad54l2	UTSW	9	106700585	missense	probably benign
PIT4495001:Rad54l2	UTSW	9	106716144	missense	probably benign	0.02
R0001:Rad54l2	UTSW	9	106708217	missense	probably damaging	0.97
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0114:Rad54l2	UTSW	9	106713455	missense	probably damaging	1.00
R0427:Rad54l2	UTSW	9	106693692	missense	possibly damaging	0.65
R0519:Rad54l2	UTSW	9	106708299	missense	probably damaging	0.98
R0760:Rad54l2	UTSW	9	106719606	critical splice donor site	probably null
R1018:Rad54l2	UTSW	9	106712390	missense	probably benign	0.32
R1701:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R1903:Rad54l2	UTSW	9	106693717	splice site	probably null
R2187:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R2205:Rad54l2	UTSW	9	106717798	missense	probably damaging	1.00
R2566:Rad54l2	UTSW	9	106703626	missense	possibly damaging	0.95
R2983:Rad54l2	UTSW	9	106700590	missense	probably benign	0.10
R3176:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3276:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3718:Rad54l2	UTSW	9	106693527	missense	probably benign
R4063:Rad54l2	UTSW	9	106720414	missense	probably benign	0.10
R4206:Rad54l2	UTSW	9	106717795	missense	probably damaging	1.00
R4271:Rad54l2	UTSW	9	106693626	missense	probably benign	0.22
R4377:Rad54l2	UTSW	9	106693222	missense	probably benign	0.00
R4700:Rad54l2	UTSW	9	106754025	missense	possibly damaging	0.85
R4729:Rad54l2	UTSW	9	106716118	missense	probably benign
R4872:Rad54l2	UTSW	9	106717892	missense	probably damaging	1.00
R4997:Rad54l2	UTSW	9	106722909	missense	possibly damaging	0.70
R5475:Rad54l2	UTSW	9	106705858	missense	probably damaging	1.00
R5658:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R6246:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R6248:Rad54l2	UTSW	9	106710338	missense	probably damaging	1.00
R6329:Rad54l2	UTSW	9	106717922	missense	possibly damaging	0.89
R6631:Rad54l2	UTSW	9	106713540	nonsense	probably null
R6773:Rad54l2	UTSW	9	106693317	missense	probably benign
R7148:Rad54l2	UTSW	9	106719119	nonsense	probably null
R7171:Rad54l2	UTSW	9	106713478	missense	probably damaging	1.00
R7226:Rad54l2	UTSW	9	106713472	missense	probably damaging	0.99
R7327:Rad54l2	UTSW	9	106693461	missense	possibly damaging	0.68
R7337:Rad54l2	UTSW	9	106705825	missense	probably damaging	1.00
R7636:Rad54l2	UTSW	9	106720387	missense	probably damaging	1.00
R7659:Rad54l2	UTSW	9	106713578	missense	probably benign	0.11
R7713:Rad54l2	UTSW	9	106717223	missense	probably damaging	1.00
R7748:Rad54l2	UTSW	9	106719034	missense	possibly damaging	0.53
R8021:Rad54l2	UTSW	9	106719641	missense	probably benign	0.00
R8084:Rad54l2	UTSW	9	106713502	missense	possibly damaging	0.63
R8552:Rad54l2	UTSW	9	106693578	missense	possibly damaging	0.77
R8768:Rad54l2	UTSW	9	106719610	missense	probably benign	0.04
R8952:Rad54l2	UTSW	9	106688851	unclassified	probably benign
R8953:Rad54l2	UTSW	9	106693262	missense	probably benign	0.02
R9041:Rad54l2	UTSW	9	106722819	missense	possibly damaging	0.85
R9296:Rad54l2	UTSW	9	106702743	missense	probably damaging	1.00
R9451:Rad54l2	UTSW	9	106708289	missense	probably benign	0.13
R9523:Rad54l2	UTSW	9	106695952	missense	probably damaging	1.00
R9657:Rad54l2	UTSW	9	106704173	missense	probably damaging	0.99
R9757:Rad54l2	UTSW	9	106717921	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATGGCTGACTCTAAGCTCACTAC -3'
(R):5'- GTCACAGGATGCCAGATGTTCCTC -3'

Sequencing Primer
(F):5'- CTACTCCAATGCCTGGAGATG -3'
(R):5'- TCAAGGGATGGACTTCATCAC -3'

Posted On

2014-04-24