Incidental Mutation 'G1patch:Thsd7a'
ID660684
Institutional Source Beutler Lab
Gene Symbol Thsd7a
Ensembl Gene ENSMUSG00000032625
Gene Namethrombospondin, type I, domain containing 7A
SynonymsLOC330267
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #G1patch (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location12311610-12749410 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12555631 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 85 (H85Y)
Ref Sequence ENSEMBL: ENSMUSP00000131662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119581] [ENSMUST00000172356]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119443
SMART Domains Protein: ENSMUSP00000113780
Gene: ENSMUSG00000032625

DomainStartEndE-ValueType
TSP1 14 70 9.98e-5 SMART
TSP1 77 161 3.14e0 SMART
TSP1 166 225 6.62e-1 SMART
Blast:TSP1 226 262 1e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000119581
AA Change: H85Y

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000113681
Gene: ENSMUSG00000032625
AA Change: H85Y

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1082 9.09e-8 SMART
TSP1 1085 1150 5.82e-1 SMART
TSP1 1155 1207 4.24e-2 SMART
TSP1 1210 1271 1e0 SMART
TSP1 1276 1328 3.55e-10 SMART
TSP1 1329 1399 7.5e-2 SMART
TSP1 1404 1462 1.55e-1 SMART
transmembrane domain 1594 1616 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172356
AA Change: H85Y

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131662
Gene: ENSMUSG00000032625
AA Change: H85Y

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 49 105 4.88e0 SMART
TSP1 186 236 1.58e-16 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 290 304 N/A INTRINSIC
TSP1 352 408 9.98e-5 SMART
TSP1 415 499 3.14e0 SMART
TSP1 504 563 6.62e-1 SMART
TSP1 626 684 1.24e-9 SMART
TSP1 687 758 1.48e0 SMART
TSP1 763 820 6.24e-6 SMART
TSP1 898 948 7.31e-2 SMART
TSP1 1027 1084 1.95e-7 SMART
TSP1 1087 1152 5.82e-1 SMART
TSP1 1157 1209 4.24e-2 SMART
TSP1 1212 1273 1e0 SMART
TSP1 1278 1330 3.55e-10 SMART
TSP1 1331 1401 7.5e-2 SMART
TSP1 1406 1464 1.55e-1 SMART
transmembrane domain 1596 1618 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found almost exclusively in endothelial cells from placenta and umbilical cord. The encoded protein appears to interact with alpha(V)beta(3) integrin and paxillin to inhibit endothelial cell migration and tube formation. This protein may be involved in cytoskeletal organization. Variations in this gene may be associated with low bone mineral density in osteoporosis. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 113,743,201 Y623C probably damaging Het
Adgrv1 T C 13: 81,437,557 E4596G probably damaging Het
Adgrv1 A T 13: 81,493,210 C3267S probably damaging Het
Ankrd40 T G 11: 94,334,815 V224G probably benign Het
Ap3s2 C T 7: 79,920,642 probably benign Het
Apip T A 2: 103,092,525 D229E possibly damaging Het
Atp2b4 C T 1: 133,706,987 R1168H probably benign Het
Bcan T C 3: 87,995,484 K329R possibly damaging Het
Camk1g T C 1: 193,350,320 D261G possibly damaging Het
Ccdc30 T A 4: 119,331,599 Q490L probably damaging Het
Ccdc83 A G 7: 90,247,053 W103R probably damaging Het
Ctsl T A 13: 64,366,623 R69* probably null Het
Dchs1 C T 7: 105,758,793 R1944H probably damaging Het
Fgb T C 3: 83,043,791 Y305C probably damaging Het
Fras1 T A 5: 96,781,340 Y3868N possibly damaging Het
Gal3st2 T A 1: 93,873,702 S27T probably benign Het
Galnt13 A G 2: 54,855,232 D228G probably damaging Het
Gk5 A T 9: 96,155,470 T346S probably benign Het
Gnrhr T C 5: 86,185,313 I233V probably damaging Het
Greb1 T C 12: 16,688,567 Y1465C probably damaging Het
H6pd A G 4: 149,996,358 L10P probably damaging Het
Hspg2 G A 4: 137,515,307 G611E probably damaging Het
Ighv7-4 A T 12: 114,222,869 D94E probably damaging Het
Lamb3 T C 1: 193,304,582 Y59H probably benign Het
Msantd1 C T 5: 34,921,421 T100I probably damaging Het
Msx3 T A 7: 140,048,746 probably benign Het
Mttp C A 3: 138,107,238 A559S probably damaging Het
Myh1 C G 11: 67,201,893 D4E probably damaging Het
Olfr1018 A G 2: 85,823,790 K273R probably damaging Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1295 C T 2: 111,564,907 C179Y probably damaging Het
Olfr596 A T 7: 103,310,354 D211V probably damaging Het
Pcdhac1 T C 18: 37,090,328 Y65H probably damaging Het
Pcdhga8 A T 18: 37,727,262 Y457F probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pja2 A T 17: 64,289,967 M514K probably damaging Het
Plcxd2 T C 16: 45,972,125 N284D probably damaging Het
Polr3d A T 14: 70,441,137 M129K probably benign Het
Ppp1r42 T G 1: 9,999,507 E110A probably damaging Het
Prdm2 G A 4: 143,132,901 T1273M possibly damaging Het
Prelid2 A G 18: 41,912,449 I132T possibly damaging Het
Sergef G A 7: 46,632,667 probably null Het
Slc24a2 C A 4: 87,226,882 probably null Het
Stxbp3 A T 3: 108,827,600 D24E possibly damaging Het
Tas2r123 A T 6: 132,847,838 M233L probably damaging Het
Tlr2 T A 3: 83,838,296 E160V probably benign Het
Tmem171 A T 13: 98,692,170 C157* probably null Het
Trpm3 T C 19: 22,926,028 Y1051H probably damaging Het
Vmn2r28 A G 7: 5,488,409 F280L probably benign Het
Xpo7 A T 14: 70,676,813 Y748N probably damaging Het
Zan T C 5: 137,438,520 S2024G unknown Het
Zfhx2 A T 14: 55,064,082 Y2148* probably null Het
Zscan4-ps1 T C 7: 11,065,979 T328A probably benign Het
Other mutations in Thsd7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Thsd7a APN 6 12379659 splice site probably null
IGL00563:Thsd7a APN 6 12379659 splice site probably null
IGL00753:Thsd7a APN 6 12327529 missense probably damaging 1.00
IGL00835:Thsd7a APN 6 12554934 missense probably damaging 1.00
IGL01486:Thsd7a APN 6 12471080 missense probably damaging 1.00
IGL01730:Thsd7a APN 6 12554981 missense probably benign 0.05
IGL01931:Thsd7a APN 6 12504099 missense probably damaging 1.00
IGL01935:Thsd7a APN 6 12317419 missense probably damaging 1.00
IGL01978:Thsd7a APN 6 12331006 missense probably benign 0.01
IGL02233:Thsd7a APN 6 12555258 missense probably benign 0.00
IGL02354:Thsd7a APN 6 12348193 splice site probably benign
IGL02361:Thsd7a APN 6 12348193 splice site probably benign
IGL02375:Thsd7a APN 6 12343265 missense probably damaging 1.00
IGL02468:Thsd7a APN 6 12318171 missense probably damaging 0.98
IGL02616:Thsd7a APN 6 12408985 missense probably damaging 0.98
IGL02820:Thsd7a APN 6 12321072 missense probably damaging 1.00
IGL02858:Thsd7a APN 6 12500995 missense probably benign 0.16
IGL03074:Thsd7a APN 6 12324681 missense probably damaging 0.99
IGL03234:Thsd7a APN 6 12343178 missense probably damaging 1.00
IGL03244:Thsd7a APN 6 12504168 splice site probably benign
IGL03337:Thsd7a APN 6 12405174 missense probably damaging 1.00
PIT4354001:Thsd7a UTSW 6 12331927 critical splice donor site probably null
R0095:Thsd7a UTSW 6 12320970 missense probably damaging 0.99
R0127:Thsd7a UTSW 6 12554908 missense probably benign 0.01
R0142:Thsd7a UTSW 6 12418335 missense probably damaging 1.00
R0226:Thsd7a UTSW 6 12321900 missense possibly damaging 0.94
R0242:Thsd7a UTSW 6 12503916 missense probably benign 0.32
R0242:Thsd7a UTSW 6 12503916 missense probably benign 0.32
R0359:Thsd7a UTSW 6 12352031 missense probably damaging 1.00
R0365:Thsd7a UTSW 6 12321887 critical splice donor site probably null
R0504:Thsd7a UTSW 6 12379594 missense probably damaging 0.99
R0512:Thsd7a UTSW 6 12379605 missense possibly damaging 0.67
R0540:Thsd7a UTSW 6 12331542 splice site probably null
R0577:Thsd7a UTSW 6 12321048 missense possibly damaging 0.50
R0607:Thsd7a UTSW 6 12331542 splice site probably null
R0755:Thsd7a UTSW 6 12555369 missense probably damaging 1.00
R0771:Thsd7a UTSW 6 12327577 missense probably benign 0.09
R0780:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0870:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0871:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0872:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R0873:Thsd7a UTSW 6 12337274 missense probably damaging 1.00
R1102:Thsd7a UTSW 6 12555702 missense possibly damaging 0.58
R1144:Thsd7a UTSW 6 12471027 splice site probably benign
R1265:Thsd7a UTSW 6 12317419 missense probably damaging 0.99
R1276:Thsd7a UTSW 6 12418370 missense probably damaging 1.00
R1381:Thsd7a UTSW 6 12555439 missense probably damaging 1.00
R1473:Thsd7a UTSW 6 12338622 missense probably benign 0.08
R1519:Thsd7a UTSW 6 12471175 missense probably benign 0.01
R1633:Thsd7a UTSW 6 12471104 nonsense probably null
R1659:Thsd7a UTSW 6 12504064 missense possibly damaging 0.73
R1769:Thsd7a UTSW 6 12555715 nonsense probably null
R1824:Thsd7a UTSW 6 12409042 splice site probably null
R1840:Thsd7a UTSW 6 12330974 missense probably benign 0.03
R1845:Thsd7a UTSW 6 12321041 missense probably damaging 1.00
R1874:Thsd7a UTSW 6 12555435 missense possibly damaging 0.76
R2023:Thsd7a UTSW 6 12327536 missense probably benign 0.16
R2039:Thsd7a UTSW 6 12408923 missense possibly damaging 0.77
R2058:Thsd7a UTSW 6 12318106 splice site probably benign
R2138:Thsd7a UTSW 6 12471073 nonsense probably null
R2155:Thsd7a UTSW 6 12379633 missense probably damaging 1.00
R2175:Thsd7a UTSW 6 12331944 missense possibly damaging 0.95
R2216:Thsd7a UTSW 6 12337268 missense possibly damaging 0.95
R2318:Thsd7a UTSW 6 12405147 missense probably damaging 1.00
R2375:Thsd7a UTSW 6 12337362 missense probably damaging 1.00
R3857:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R3858:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R3890:Thsd7a UTSW 6 12418337 missense probably benign 0.09
R3910:Thsd7a UTSW 6 12331549 missense probably damaging 0.96
R3933:Thsd7a UTSW 6 12555226 missense probably benign 0.15
R4369:Thsd7a UTSW 6 12468908 missense probably damaging 1.00
R4447:Thsd7a UTSW 6 12324635 missense probably damaging 0.98
R4664:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4664:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4665:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4665:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4666:Thsd7a UTSW 6 12337314 missense possibly damaging 0.79
R4666:Thsd7a UTSW 6 12504013 missense possibly damaging 0.90
R4668:Thsd7a UTSW 6 12408968 missense probably damaging 0.98
R4886:Thsd7a UTSW 6 12327660 nonsense probably null
R4918:Thsd7a UTSW 6 12327559 missense probably damaging 1.00
R4938:Thsd7a UTSW 6 12330992 missense probably benign 0.09
R5064:Thsd7a UTSW 6 12330952 missense possibly damaging 0.66
R5153:Thsd7a UTSW 6 12338655 missense probably benign 0.00
R5177:Thsd7a UTSW 6 12379583 nonsense probably null
R5242:Thsd7a UTSW 6 12327583 missense probably damaging 1.00
R5267:Thsd7a UTSW 6 12379602 missense probably damaging 1.00
R5442:Thsd7a UTSW 6 12748800 missense probably benign 0.00
R5506:Thsd7a UTSW 6 12332017 missense possibly damaging 0.85
R5525:Thsd7a UTSW 6 12332007 missense possibly damaging 0.52
R5544:Thsd7a UTSW 6 12379471 missense possibly damaging 0.94
R5651:Thsd7a UTSW 6 12343213 missense probably damaging 1.00
R5716:Thsd7a UTSW 6 12343148 missense probably benign 0.00
R5848:Thsd7a UTSW 6 12503923 missense probably damaging 1.00
R5958:Thsd7a UTSW 6 12337262 missense probably benign 0.02
R6012:Thsd7a UTSW 6 12379389 splice site probably null
R6139:Thsd7a UTSW 6 12379573 missense possibly damaging 0.93
R6243:Thsd7a UTSW 6 12327602 missense probably damaging 1.00
R6257:Thsd7a UTSW 6 12408988 nonsense probably null
R6273:Thsd7a UTSW 6 12408836 missense probably damaging 0.99
R6300:Thsd7a UTSW 6 12471104 nonsense probably null
R6314:Thsd7a UTSW 6 12554997 missense possibly damaging 0.87
R6392:Thsd7a UTSW 6 12468929 missense probably damaging 0.99
R6418:Thsd7a UTSW 6 12555082 nonsense probably null
R6515:Thsd7a UTSW 6 12501086 missense possibly damaging 0.47
R6725:Thsd7a UTSW 6 12555631 missense possibly damaging 0.87
R6742:Thsd7a UTSW 6 12408816 missense probably damaging 1.00
R6776:Thsd7a UTSW 6 12555637 missense possibly damaging 0.53
R6838:Thsd7a UTSW 6 12504075 missense probably damaging 0.99
R7104:Thsd7a UTSW 6 12379430 missense
R7170:Thsd7a UTSW 6 12352091 missense
R7349:Thsd7a UTSW 6 12352068 missense
R7460:Thsd7a UTSW 6 12554934 missense
R7467:Thsd7a UTSW 6 12331585 missense
R7666:Thsd7a UTSW 6 12379438 missense
R7869:Thsd7a UTSW 6 12471124 nonsense probably null
R8032:Thsd7a UTSW 6 12555288 missense
R8165:Thsd7a UTSW 6 12468963 missense
R8167:Thsd7a UTSW 6 12317401 nonsense probably null
R8245:Thsd7a UTSW 6 12379593 missense
R8310:Thsd7a UTSW 6 12396613 missense
R8312:Thsd7a UTSW 6 12471182 missense
R8331:Thsd7a UTSW 6 12471158 missense
R8755:Thsd7a UTSW 6 12408852 nonsense probably null
R8843:Thsd7a UTSW 6 12501137 missense
R8867:Thsd7a UTSW 6 12338687 missense
Predicted Primers PCR Primer
(F):5'- ACTCGCAGATGATGTCCTCG -3'
(R):5'- GCTAGAGACGTCTTTCTAAAATGGG -3'

Sequencing Primer
(F):5'- ATGTCCTCGGCGGGAATGTC -3'
(R):5'- GGAAAAGCGTGTCACTTGCTTCC -3'
Posted On2021-02-01