Mutagenetix > Incidental Mutation

Incidental Mutation 'R1102:Thsd7a'

98166

Institutional Source

Beutler Lab

Gene Symbol

Thsd7a

Ensembl Gene

ENSMUSG00000032625

Gene Name

thrombospondin, type I, domain containing 7A

Synonyms

LOC330267

MMRRC Submission

039175-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1102 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12311610-12749410 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12555702 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 61 (D61G)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119581] [ENSMUST00000172356]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000046121
AA Change: D61G

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000040176
Gene: ENSMUSG00000032625
AA Change: D61G

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1084	1.2e-7	SMART
TSP1	1087	1152	5.82e-1	SMART
TSP1	1157	1209	4.24e-2	SMART
TSP1	1212	1273	1e0	SMART
TSP1	1278	1330	3.55e-10	SMART
TSP1	1331	1401	7.5e-2	SMART
TSP1	1406	1464	1.55e-1	SMART
transmembrane domain	1596	1618	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000119443

SMART Domains

Protein: ENSMUSP00000113780
Gene: ENSMUSG00000032625

Domain	Start	End	E-Value	Type
TSP1	14	70	9.98e-5	SMART
TSP1	77	161	3.14e0	SMART
TSP1	166	225	6.62e-1	SMART
Blast:TSP1	226	262	1e-8	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000119581
AA Change: D61G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000113681
Gene: ENSMUSG00000032625
AA Change: D61G

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1082	9.09e-8	SMART
TSP1	1085	1150	5.82e-1	SMART
TSP1	1155	1207	4.24e-2	SMART
TSP1	1210	1271	1e0	SMART
TSP1	1276	1328	3.55e-10	SMART
TSP1	1329	1399	7.5e-2	SMART
TSP1	1404	1462	1.55e-1	SMART
transmembrane domain	1594	1616	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172356
AA Change: D61G

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000131662
Gene: ENSMUSG00000032625
AA Change: D61G

Domain	Start	End	E-Value	Type
signal peptide	1	38	N/A	INTRINSIC
TSP1	49	105	4.88e0	SMART
TSP1	186	236	1.58e-16	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	290	304	N/A	INTRINSIC
TSP1	352	408	9.98e-5	SMART
TSP1	415	499	3.14e0	SMART
TSP1	504	563	6.62e-1	SMART
TSP1	626	684	1.24e-9	SMART
TSP1	687	758	1.48e0	SMART
TSP1	763	820	6.24e-6	SMART
TSP1	898	948	7.31e-2	SMART
TSP1	1027	1084	1.95e-7	SMART
TSP1	1087	1152	5.82e-1	SMART
TSP1	1157	1209	4.24e-2	SMART
TSP1	1212	1273	1e0	SMART
TSP1	1278	1330	3.55e-10	SMART
TSP1	1331	1401	7.5e-2	SMART
TSP1	1406	1464	1.55e-1	SMART
transmembrane domain	1596	1618	N/A	INTRINSIC

Meta Mutation Damage Score

0.0816

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 88.8%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found almost exclusively in endothelial cells from placenta and umbilical cord. The encoded protein appears to interact with alpha(V)beta(3) integrin and paxillin to inhibit endothelial cell migration and tube formation. This protein may be involved in cytoskeletal organization. Variations in this gene may be associated with low bone mineral density in osteoporosis. [provided by RefSeq, Aug 2010]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	C	T	17: 8,992,628	T203M	probably damaging	Het
1700021F07Rik	T	A	2: 173,522,723	D20E	probably damaging	Het
4933416C03Rik	T	C	10: 116,113,394	S76G	probably damaging	Het
Acy3	C	T	19: 3,987,850	T119I	probably damaging	Het
AU022751	GTCATCATCATCATC	GTCATCATCATCATCATC	X: 6,082,591		probably benign	Het
Ccdc6	C	A	10: 70,187,806	H400Q	possibly damaging	Het
Ccna1	T	C	3: 55,050,860	D134G	probably damaging	Het
Cct2	A	T	10: 117,060,640		probably null	Het
Cd36	A	G	5: 17,814,213	F170S	possibly damaging	Het
Cep350	G	A	1: 155,931,518	P718S	probably damaging	Het
Ctnna3	A	T	10: 64,585,995	I523L	probably benign	Het
Dnah1	G	T	14: 31,296,457	Y1405*	probably null	Het
Dnah8	T	A	17: 30,854,764		probably null	Het
Drd3	T	C	16: 43,762,483	L113S	probably damaging	Het
Emsy	T	C	7: 98,602,589	T735A	probably damaging	Het
Epha5	A	G	5: 84,233,575		probably benign	Het
Fbxo10	A	G	4: 45,043,672	L717P	probably damaging	Het
Galnt10	T	C	11: 57,781,045		probably benign	Het
Gle1	T	G	2: 29,944,054	I437M	possibly damaging	Het
Gm8765	A	G	13: 50,703,082	T919A	probably benign	Het
Gpr137b	T	C	13: 13,365,031		probably benign	Het
Gsta1	T	C	9: 78,242,495	F197L	probably damaging	Het
Icam1	G	A	9: 21,027,836	V502M	possibly damaging	Het
Ido1	T	A	8: 24,593,140	I90F	probably damaging	Het
Il4ra	G	A	7: 125,574,717		probably null	Het
Med12l	T	A	3: 59,244,836	M1014K	probably damaging	Het
Mmp13	A	G	9: 7,272,952	E104G	possibly damaging	Het
Mms19	T	C	19: 41,950,845	E495G	possibly damaging	Het
Mrc2	A	G	11: 105,340,821	I820V	probably benign	Het
Naip6	T	C	13: 100,304,415	K286E	possibly damaging	Het
Ndrg1	T	C	15: 66,944,836	Y110C	probably damaging	Het
Olfr1251	A	T	2: 89,667,470	C139S	probably damaging	Het
Olfr1469	G	A	19: 13,411,090	V174M	probably damaging	Het
Olfr1474	T	C	19: 13,471,407	C146R	probably damaging	Het
Olfr376	G	A	11: 73,374,874	V45I	probably benign	Het
Oxtr	C	T	6: 112,477,177	R42Q	probably benign	Het
Pdzd4	G	A	X: 73,795,446	R419C	probably damaging	Het
Pnpla7	G	T	2: 24,996,165	M3I	probably damaging	Het
Popdc3	A	G	10: 45,316,546		probably benign	Het
Ppp5c	A	G	7: 17,022,443	F112S	probably benign	Het
Rbp3	A	G	14: 33,956,356	T754A	possibly damaging	Het
Reep6	A	G	10: 80,335,246	T319A	probably benign	Het
Rfx3	A	G	19: 27,867,600	V43A	possibly damaging	Het
Rint1	A	G	5: 23,805,567		probably benign	Het
Sacm1l	T	G	9: 123,582,298	V384G	probably damaging	Het
Shox2	A	T	3: 66,978,295	L149Q	probably damaging	Het
Sipa1	T	C	19: 5,652,754	H805R	probably benign	Het
Skiv2l	T	C	17: 34,840,106	D1095G	probably benign	Het
Slc5a3	G	T	16: 92,077,877	W274L	probably damaging	Het
Sptbn1	G	T	11: 30,120,785	H1524Q	possibly damaging	Het
Ssr1	G	T	13: 37,987,615	Q149K	probably benign	Het
Tmem245	T	C	4: 56,903,200		probably benign	Het
Tmem74	T	C	15: 43,866,790	T286A	probably benign	Het
Tnc	T	C	4: 64,020,468	N45D	probably benign	Het
Trdmt1	T	G	2: 13,523,414		probably benign	Het
Uty	A	T	Y: 1,174,741	Y220N	probably damaging	Het
Vdr	T	C	15: 97,859,121	Y290C	probably damaging	Het
Vmn2r19	T	A	6: 123,336,173	M734K	probably benign	Het
Vmn2r53	T	C	7: 12,598,483	D413G	possibly damaging	Het
Vps45	A	G	3: 96,042,941		probably benign	Het

Other mutations in Thsd7a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00562:Thsd7a	APN	6	12379659	splice site	probably null
IGL00563:Thsd7a	APN	6	12379659	splice site	probably null
IGL00753:Thsd7a	APN	6	12327529	missense	probably damaging	1.00
IGL00835:Thsd7a	APN	6	12554934	missense	probably damaging	1.00
IGL01486:Thsd7a	APN	6	12471080	missense	probably damaging	1.00
IGL01730:Thsd7a	APN	6	12554981	missense	probably benign	0.05
IGL01931:Thsd7a	APN	6	12504099	missense	probably damaging	1.00
IGL01935:Thsd7a	APN	6	12317419	missense	probably damaging	1.00
IGL01978:Thsd7a	APN	6	12331006	missense	probably benign	0.01
IGL02233:Thsd7a	APN	6	12555258	missense	probably benign	0.00
IGL02354:Thsd7a	APN	6	12348193	splice site	probably benign
IGL02361:Thsd7a	APN	6	12348193	splice site	probably benign
IGL02375:Thsd7a	APN	6	12343265	missense	probably damaging	1.00
IGL02468:Thsd7a	APN	6	12318171	missense	probably damaging	0.98
IGL02616:Thsd7a	APN	6	12408985	missense	probably damaging	0.98
IGL02820:Thsd7a	APN	6	12321072	missense	probably damaging	1.00
IGL02858:Thsd7a	APN	6	12500995	missense	probably benign	0.16
IGL03074:Thsd7a	APN	6	12324681	missense	probably damaging	0.99
IGL03234:Thsd7a	APN	6	12343178	missense	probably damaging	1.00
IGL03244:Thsd7a	APN	6	12504168	splice site	probably benign
IGL03337:Thsd7a	APN	6	12405174	missense	probably damaging	1.00
G1patch:Thsd7a	UTSW	6	12555631	missense	possibly damaging	0.87
PIT4354001:Thsd7a	UTSW	6	12331927	critical splice donor site	probably null
R0095:Thsd7a	UTSW	6	12320970	missense	probably damaging	0.99
R0127:Thsd7a	UTSW	6	12554908	missense	probably benign	0.01
R0142:Thsd7a	UTSW	6	12418335	missense	probably damaging	1.00
R0226:Thsd7a	UTSW	6	12321900	missense	possibly damaging	0.94
R0242:Thsd7a	UTSW	6	12503916	missense	probably benign	0.32
R0242:Thsd7a	UTSW	6	12503916	missense	probably benign	0.32
R0359:Thsd7a	UTSW	6	12352031	missense	probably damaging	1.00
R0365:Thsd7a	UTSW	6	12321887	critical splice donor site	probably null
R0504:Thsd7a	UTSW	6	12379594	missense	probably damaging	0.99
R0512:Thsd7a	UTSW	6	12379605	missense	possibly damaging	0.67
R0540:Thsd7a	UTSW	6	12331542	splice site	probably null
R0577:Thsd7a	UTSW	6	12321048	missense	possibly damaging	0.50
R0607:Thsd7a	UTSW	6	12331542	splice site	probably null
R0755:Thsd7a	UTSW	6	12555369	missense	probably damaging	1.00
R0771:Thsd7a	UTSW	6	12327577	missense	probably benign	0.09
R0780:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0870:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0871:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0872:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R0873:Thsd7a	UTSW	6	12337274	missense	probably damaging	1.00
R1144:Thsd7a	UTSW	6	12471027	splice site	probably benign
R1265:Thsd7a	UTSW	6	12317419	missense	probably damaging	0.99
R1276:Thsd7a	UTSW	6	12418370	missense	probably damaging	1.00
R1381:Thsd7a	UTSW	6	12555439	missense	probably damaging	1.00
R1473:Thsd7a	UTSW	6	12338622	missense	probably benign	0.08
R1519:Thsd7a	UTSW	6	12471175	missense	probably benign	0.01
R1633:Thsd7a	UTSW	6	12471104	nonsense	probably null
R1659:Thsd7a	UTSW	6	12504064	missense	possibly damaging	0.73
R1769:Thsd7a	UTSW	6	12555715	nonsense	probably null
R1824:Thsd7a	UTSW	6	12409042	splice site	probably null
R1840:Thsd7a	UTSW	6	12330974	missense	probably benign	0.03
R1845:Thsd7a	UTSW	6	12321041	missense	probably damaging	1.00
R1874:Thsd7a	UTSW	6	12555435	missense	possibly damaging	0.76
R2023:Thsd7a	UTSW	6	12327536	missense	probably benign	0.16
R2039:Thsd7a	UTSW	6	12408923	missense	possibly damaging	0.77
R2058:Thsd7a	UTSW	6	12318106	splice site	probably benign
R2138:Thsd7a	UTSW	6	12471073	nonsense	probably null
R2155:Thsd7a	UTSW	6	12379633	missense	probably damaging	1.00
R2175:Thsd7a	UTSW	6	12331944	missense	possibly damaging	0.95
R2216:Thsd7a	UTSW	6	12337268	missense	possibly damaging	0.95
R2318:Thsd7a	UTSW	6	12405147	missense	probably damaging	1.00
R2375:Thsd7a	UTSW	6	12337362	missense	probably damaging	1.00
R3857:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R3858:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R3890:Thsd7a	UTSW	6	12418337	missense	probably benign	0.09
R3910:Thsd7a	UTSW	6	12331549	missense	probably damaging	0.96
R3933:Thsd7a	UTSW	6	12555226	missense	probably benign	0.15
R4369:Thsd7a	UTSW	6	12468908	missense	probably damaging	1.00
R4447:Thsd7a	UTSW	6	12324635	missense	probably damaging	0.98
R4664:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4664:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4665:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4665:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4666:Thsd7a	UTSW	6	12337314	missense	possibly damaging	0.79
R4666:Thsd7a	UTSW	6	12504013	missense	possibly damaging	0.90
R4668:Thsd7a	UTSW	6	12408968	missense	probably damaging	0.98
R4886:Thsd7a	UTSW	6	12327660	nonsense	probably null
R4918:Thsd7a	UTSW	6	12327559	missense	probably damaging	1.00
R4938:Thsd7a	UTSW	6	12330992	missense	probably benign	0.09
R5064:Thsd7a	UTSW	6	12330952	missense	possibly damaging	0.66
R5153:Thsd7a	UTSW	6	12338655	missense	probably benign	0.00
R5177:Thsd7a	UTSW	6	12379583	nonsense	probably null
R5242:Thsd7a	UTSW	6	12327583	missense	probably damaging	1.00
R5267:Thsd7a	UTSW	6	12379602	missense	probably damaging	1.00
R5442:Thsd7a	UTSW	6	12748800	missense	probably benign	0.00
R5506:Thsd7a	UTSW	6	12332017	missense	possibly damaging	0.85
R5525:Thsd7a	UTSW	6	12332007	missense	possibly damaging	0.52
R5544:Thsd7a	UTSW	6	12379471	missense	possibly damaging	0.94
R5651:Thsd7a	UTSW	6	12343213	missense	probably damaging	1.00
R5716:Thsd7a	UTSW	6	12343148	missense	probably benign	0.00
R5848:Thsd7a	UTSW	6	12503923	missense	probably damaging	1.00
R5958:Thsd7a	UTSW	6	12337262	missense	probably benign	0.02
R6012:Thsd7a	UTSW	6	12379389	splice site	probably null
R6139:Thsd7a	UTSW	6	12379573	missense	possibly damaging	0.93
R6243:Thsd7a	UTSW	6	12327602	missense	probably damaging	1.00
R6257:Thsd7a	UTSW	6	12408988	nonsense	probably null
R6273:Thsd7a	UTSW	6	12408836	missense	probably damaging	0.99
R6300:Thsd7a	UTSW	6	12471104	nonsense	probably null
R6314:Thsd7a	UTSW	6	12554997	missense	possibly damaging	0.87
R6392:Thsd7a	UTSW	6	12468929	missense	probably damaging	0.99
R6418:Thsd7a	UTSW	6	12555082	nonsense	probably null
R6515:Thsd7a	UTSW	6	12501086	missense	possibly damaging	0.47
R6725:Thsd7a	UTSW	6	12555631	missense	possibly damaging	0.87
R6742:Thsd7a	UTSW	6	12408816	missense	probably damaging	1.00
R6776:Thsd7a	UTSW	6	12555637	missense	possibly damaging	0.53
R6838:Thsd7a	UTSW	6	12504075	missense	probably damaging	0.99
R7104:Thsd7a	UTSW	6	12379430	missense
R7170:Thsd7a	UTSW	6	12352091	missense
R7349:Thsd7a	UTSW	6	12352068	missense
R7460:Thsd7a	UTSW	6	12554934	missense
R7467:Thsd7a	UTSW	6	12331585	missense
R7666:Thsd7a	UTSW	6	12379438	missense
R7869:Thsd7a	UTSW	6	12471124	nonsense	probably null
R8032:Thsd7a	UTSW	6	12555288	missense
R8165:Thsd7a	UTSW	6	12468963	missense
R8167:Thsd7a	UTSW	6	12317401	nonsense	probably null
R8245:Thsd7a	UTSW	6	12379593	missense
R8310:Thsd7a	UTSW	6	12396613	missense
R8312:Thsd7a	UTSW	6	12471182	missense
R8331:Thsd7a	UTSW	6	12471158	missense
R8755:Thsd7a	UTSW	6	12408852	nonsense	probably null
R8843:Thsd7a	UTSW	6	12501137	missense
R8867:Thsd7a	UTSW	6	12338687	missense
R8952:Thsd7a	UTSW	6	12468993	missense	probably damaging	0.98
R9036:Thsd7a	UTSW	6	12418250	missense
R9299:Thsd7a	UTSW	6	12504132	missense
R9366:Thsd7a	UTSW	6	12555481	missense
R9489:Thsd7a	UTSW	6	12352023	missense

Predicted Primers

PCR Primer
(F):5'- AGTCGTACAATTCCTTGTGCCAGTC -3'
(R):5'- AGGCAAGAGTAATGGGTTTTCACCG -3'

Sequencing Primer
(F):5'- TGTGCCAGTCACAGACCTTG -3'
(R):5'- CCTCTTGTGAAAGTACTCAGGGAC -3'

Posted On

2014-01-05