Incidental Mutation 'R8676:Zfp975'
ID 661384
Institutional Source Beutler Lab
Gene Symbol Zfp975
Ensembl Gene ENSMUSG00000069727
Gene Name zinc finger protein 975
Synonyms Gm5595
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R8676 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 42660105-42692742 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 42662840 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 116 (S116R)
Ref Sequence ENSEMBL: ENSMUSP00000103626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107992]
AlphaFold Q6NVD6
Predicted Effect probably benign
Transcript: ENSMUST00000107992
AA Change: S116R

PolyPhen 2 Score 0.441 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103626
Gene: ENSMUSG00000069727
AA Change: S116R

DomainStartEndE-ValueType
KRAB 4 66 1.53e-19 SMART
ZnF_C2H2 131 153 7.78e-3 SMART
ZnF_C2H2 159 181 9.73e-4 SMART
ZnF_C2H2 187 209 1.47e-3 SMART
ZnF_C2H2 215 237 3.89e-3 SMART
ZnF_C2H2 243 265 2.57e-3 SMART
ZnF_C2H2 271 293 7.26e-3 SMART
ZnF_C2H2 299 321 1.58e-3 SMART
ZnF_C2H2 327 349 7.9e-4 SMART
ZnF_C2H2 355 377 5.9e-3 SMART
ZnF_C2H2 383 405 1.58e-3 SMART
ZnF_C2H2 411 433 6.32e-3 SMART
ZnF_C2H2 439 461 8.47e-4 SMART
ZnF_C2H2 467 489 2.57e-3 SMART
ZnF_C2H2 495 517 3.16e-3 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (54/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,895,599 N152D unknown Het
1700021F05Rik A G 10: 43,532,937 L70S probably benign Het
Acsm3 T A 7: 119,775,169 S281R probably damaging Het
Adipor2 G T 6: 119,363,486 probably benign Het
Alk T C 17: 71,897,941 S1079G probably damaging Het
Ankrd27 T C 7: 35,602,584 probably null Het
Anxa6 C A 11: 55,001,282 E283* probably null Het
Bnc2 T C 4: 84,276,313 H858R possibly damaging Het
Btnl6 T C 17: 34,508,069 S496G probably benign Het
Ccdc88a T C 11: 29,460,860 S449P probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cfap43 A T 19: 47,748,017 L1345H possibly damaging Het
Cyld A T 8: 88,729,510 H396L probably benign Het
Cyp20a1 A G 1: 60,379,420 T340A possibly damaging Het
Dera A T 6: 137,830,204 I217F probably damaging Het
Dnah11 A G 12: 118,190,804 L247P probably damaging Het
Eftud2 G A 11: 102,868,621 T152M probably damaging Het
Epb41l2 C T 10: 25,443,776 T169M probably benign Het
Fam186a T C 15: 99,947,142 D407G unknown Het
Fam189a2 T C 19: 23,988,494 K214E probably damaging Het
Gli3 T A 13: 15,715,034 C578S probably damaging Het
Gm436 G A 4: 144,670,113 R350C possibly damaging Het
Gm6408 A G 5: 146,482,427 N84S probably benign Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Herc2 C A 7: 56,188,613 T3296K probably damaging Het
Hnf4g A T 3: 3,643,073 probably benign Het
Hyal4 C A 6: 24,755,827 Q15K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcna3 A G 3: 107,036,592 E57G probably damaging Het
Kcnc3 C A 7: 44,591,596 D237E probably benign Het
Map3k8 A G 18: 4,343,137 V130A probably benign Het
Mpp7 A G 18: 7,440,430 probably null Het
Myh13 T A 11: 67,342,485 L610Q probably damaging Het
Olfr1020 T A 2: 85,849,902 M150K probably benign Het
Olfr1339 C A 4: 118,735,038 P170T probably damaging Het
Olfr917 T C 9: 38,665,768 I25M probably benign Het
Pcdhb5 A T 18: 37,321,076 T170S probably benign Het
Polr3b T A 10: 84,680,387 H626Q probably benign Het
Prkg1 A T 19: 31,764,746 L26Q probably damaging Het
Prob1 T C 18: 35,653,986 N405S possibly damaging Het
Proz T G 8: 13,073,630 S300R probably damaging Het
Psg19 A G 7: 18,794,065 I251T probably benign Het
Rcbtb1 T C 14: 59,229,952 I413T possibly damaging Het
Rnf144b T A 13: 47,228,976 Y103N probably damaging Het
Rspry1 G C 8: 94,632,119 G194R probably benign Het
Scn2b A G 9: 45,125,619 I142V probably damaging Het
Spata20 A T 11: 94,481,781 L588H probably damaging Het
Stk32b T A 5: 37,457,159 H335L probably benign Het
Taar4 A C 10: 23,960,903 D137A possibly damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tek A T 4: 94,849,837 H708L probably benign Het
Tmem89 C T 9: 108,915,027 L132F unknown Het
Ugt2b38 T C 5: 87,411,822 I404V probably benign Het
Vmn1r16 C T 6: 57,322,829 M269I probably benign Het
Vmn1r201 A G 13: 22,475,252 K212R probably damaging Het
Vmn2r11 A C 5: 109,053,760 F293V probably damaging Het
Zdhhc17 A T 10: 110,962,379 probably benign Het
Zfp423 C A 8: 87,782,710 M335I probably benign Het
Zfp74 T C 7: 29,934,654 Y543C probably damaging Het
Other mutations in Zfp975
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:Zfp975 APN 7 42662791 missense probably damaging 1.00
R0194:Zfp975 UTSW 7 42662492 missense probably benign 0.02
R0662:Zfp975 UTSW 7 42662526 missense probably benign 0.02
R1491:Zfp975 UTSW 7 42662812 missense probably benign 0.19
R1573:Zfp975 UTSW 7 42662083 missense probably benign 0.03
R1738:Zfp975 UTSW 7 42662949 missense probably benign 0.05
R1833:Zfp975 UTSW 7 42661839 missense probably benign 0.01
R2185:Zfp975 UTSW 7 42661681 missense possibly damaging 0.90
R4031:Zfp975 UTSW 7 42662953 nonsense probably null
R4090:Zfp975 UTSW 7 42662874 missense probably benign 0.10
R4356:Zfp975 UTSW 7 42661827 missense probably damaging 1.00
R4631:Zfp975 UTSW 7 42662945 missense probably benign 0.09
R4795:Zfp975 UTSW 7 42665146 critical splice acceptor site probably null
R4896:Zfp975 UTSW 7 42662292 missense probably damaging 1.00
R5266:Zfp975 UTSW 7 42662230 missense probably damaging 1.00
R5267:Zfp975 UTSW 7 42662230 missense probably damaging 1.00
R5580:Zfp975 UTSW 7 42665089 nonsense probably null
R5874:Zfp975 UTSW 7 42662888 missense probably benign 0.00
R5898:Zfp975 UTSW 7 42662539 missense probably damaging 1.00
R6529:Zfp975 UTSW 7 42661901 missense possibly damaging 0.79
R6782:Zfp975 UTSW 7 42662030 missense probably benign 0.41
R6937:Zfp975 UTSW 7 42665056 missense possibly damaging 0.61
R7088:Zfp975 UTSW 7 42662672 missense probably benign 0.02
R7233:Zfp975 UTSW 7 42662494 missense probably benign 0.38
R7253:Zfp975 UTSW 7 42661612 makesense probably null
R7358:Zfp975 UTSW 7 42662791 missense probably damaging 1.00
R7659:Zfp975 UTSW 7 42662424 missense probably benign 0.00
R7999:Zfp975 UTSW 7 42662932 missense probably benign 0.02
R8957:Zfp975 UTSW 7 42661733 missense probably damaging 1.00
R9274:Zfp975 UTSW 7 42662875 missense probably benign 0.02
R9326:Zfp975 UTSW 7 42662413 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATTACATTGGTAAGGTTTCTCTCC -3'
(R):5'- ATGTCCCAATTATCATTGCAGGC -3'

Sequencing Primer
(F):5'- TCATGCATTCGAAGATAGCTGG -3'
(R):5'- TTATCATTGCAGGCACGAAAG -3'
Posted On 2021-03-08