Incidental Mutation 'R8676:Tmem89'
ID 661394
Institutional Source Beutler Lab
Gene Symbol Tmem89
Ensembl Gene ENSMUSG00000025652
Gene Name transmembrane protein 89
Synonyms 1700024B07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock # R8676 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 108914619-108915563 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 108915027 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 132 (L132F)
Ref Sequence ENSEMBL: ENSMUSP00000142016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026744] [ENSMUST00000098376] [ENSMUST00000192852]
AlphaFold Q9DA04
Predicted Effect probably benign
Transcript: ENSMUST00000026744
SMART Domains Protein: ENSMUSP00000026744
Gene: ENSMUSG00000025652

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TMEM89 23 47 6.3e-16 PFAM
Pfam:TMEM89 46 166 1.1e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098376
SMART Domains Protein: ENSMUSP00000095979
Gene: ENSMUSG00000023259

DomainStartEndE-ValueType
Pfam:Sulfate_transp 69 458 4.4e-113 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 2e-16 PDB
low complexity region 554 593 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191404
Predicted Effect unknown
Transcript: ENSMUST00000192852
AA Change: L132F
SMART Domains Protein: ENSMUSP00000142016
Gene: ENSMUSG00000025652
AA Change: L132F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TMEM89 23 47 1.8e-15 PFAM
Pfam:TMEM89 45 118 1.3e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (54/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,895,599 N152D unknown Het
1700021F05Rik A G 10: 43,532,937 L70S probably benign Het
Acsm3 T A 7: 119,775,169 S281R probably damaging Het
Adipor2 G T 6: 119,363,486 probably benign Het
Alk T C 17: 71,897,941 S1079G probably damaging Het
Ankrd27 T C 7: 35,602,584 probably null Het
Anxa6 C A 11: 55,001,282 E283* probably null Het
Bnc2 T C 4: 84,276,313 H858R possibly damaging Het
Btnl6 T C 17: 34,508,069 S496G probably benign Het
Ccdc88a T C 11: 29,460,860 S449P probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cfap43 A T 19: 47,748,017 L1345H possibly damaging Het
Cyld A T 8: 88,729,510 H396L probably benign Het
Cyp20a1 A G 1: 60,379,420 T340A possibly damaging Het
Dera A T 6: 137,830,204 I217F probably damaging Het
Dnah11 A G 12: 118,190,804 L247P probably damaging Het
Eftud2 G A 11: 102,868,621 T152M probably damaging Het
Epb41l2 C T 10: 25,443,776 T169M probably benign Het
Fam186a T C 15: 99,947,142 D407G unknown Het
Fam189a2 T C 19: 23,988,494 K214E probably damaging Het
Gli3 T A 13: 15,715,034 C578S probably damaging Het
Gm436 G A 4: 144,670,113 R350C possibly damaging Het
Gm6408 A G 5: 146,482,427 N84S probably benign Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Herc2 C A 7: 56,188,613 T3296K probably damaging Het
Hnf4g A T 3: 3,643,073 probably benign Het
Hyal4 C A 6: 24,755,827 Q15K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcna3 A G 3: 107,036,592 E57G probably damaging Het
Kcnc3 C A 7: 44,591,596 D237E probably benign Het
Map3k8 A G 18: 4,343,137 V130A probably benign Het
Mpp7 A G 18: 7,440,430 probably null Het
Myh13 T A 11: 67,342,485 L610Q probably damaging Het
Olfr1020 T A 2: 85,849,902 M150K probably benign Het
Olfr1339 C A 4: 118,735,038 P170T probably damaging Het
Olfr917 T C 9: 38,665,768 I25M probably benign Het
Pcdhb5 A T 18: 37,321,076 T170S probably benign Het
Polr3b T A 10: 84,680,387 H626Q probably benign Het
Prkg1 A T 19: 31,764,746 L26Q probably damaging Het
Prob1 T C 18: 35,653,986 N405S possibly damaging Het
Proz T G 8: 13,073,630 S300R probably damaging Het
Psg19 A G 7: 18,794,065 I251T probably benign Het
Rcbtb1 T C 14: 59,229,952 I413T possibly damaging Het
Rnf144b T A 13: 47,228,976 Y103N probably damaging Het
Rspry1 G C 8: 94,632,119 G194R probably benign Het
Scn2b A G 9: 45,125,619 I142V probably damaging Het
Spata20 A T 11: 94,481,781 L588H probably damaging Het
Stk32b T A 5: 37,457,159 H335L probably benign Het
Taar4 A C 10: 23,960,903 D137A possibly damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tek A T 4: 94,849,837 H708L probably benign Het
Ugt2b38 T C 5: 87,411,822 I404V probably benign Het
Vmn1r16 C T 6: 57,322,829 M269I probably benign Het
Vmn1r201 A G 13: 22,475,252 K212R probably damaging Het
Vmn2r11 A C 5: 109,053,760 F293V probably damaging Het
Zdhhc17 A T 10: 110,962,379 probably benign Het
Zfp423 C A 8: 87,782,710 M335I probably benign Het
Zfp74 T C 7: 29,934,654 Y543C probably damaging Het
Zfp975 A T 7: 42,662,840 S116R probably benign Het
Other mutations in Tmem89
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0060:Tmem89 UTSW 9 108915417 missense probably damaging 1.00
R0060:Tmem89 UTSW 9 108915417 missense probably damaging 1.00
R0063:Tmem89 UTSW 9 108914812 missense probably benign 0.00
R0063:Tmem89 UTSW 9 108914812 missense probably benign 0.00
R2447:Tmem89 UTSW 9 108914800 missense probably damaging 0.98
R4778:Tmem89 UTSW 9 108915375 missense probably damaging 0.98
R4906:Tmem89 UTSW 9 108914761 unclassified probably benign
R5529:Tmem89 UTSW 9 108915477 missense probably damaging 0.98
R9095:Tmem89 UTSW 9 108914661 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGAAATCGCATCTACCCCG -3'
(R):5'- CTTTCCAGTGTTTGCCGGAG -3'

Sequencing Primer
(F):5'- GTGGCTGGGGTCACAATCAC -3'
(R):5'- GGAATAGGTCACTGGGTCTCC -3'
Posted On 2021-03-08