Incidental Mutation 'R8676:Heatr5a'
ID 661405
Institutional Source Beutler Lab
Gene Symbol Heatr5a
Ensembl Gene ENSMUSG00000035181
Gene Name HEAT repeat containing 5A
Synonyms D930036F22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock # R8676 (G1)
Quality Score 214.492
Status Not validated
Chromosome 12
Chromosomal Location 51875871-51971321 bp(-) (GRCm38)
Type of Mutation critical splice donor site
DNA Base Change (assembly) AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA to AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA at 51887919 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040583]
AlphaFold Q5PRF0
Predicted Effect probably benign
Transcript: ENSMUST00000040583
SMART Domains Protein: ENSMUSP00000043115
Gene: ENSMUSG00000035181

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
SCOP:d1qbkb_ 112 658 6e-13 SMART
low complexity region 1063 1078 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1110 1120 N/A INTRINSIC
low complexity region 1122 1135 N/A INTRINSIC
low complexity region 1496 1507 N/A INTRINSIC
low complexity region 1722 1735 N/A INTRINSIC
low complexity region 1925 1936 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (54/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,895,599 N152D unknown Het
1700021F05Rik A G 10: 43,532,937 L70S probably benign Het
Acsm3 T A 7: 119,775,169 S281R probably damaging Het
Adipor2 G T 6: 119,363,486 probably benign Het
Alk T C 17: 71,897,941 S1079G probably damaging Het
Ankrd27 T C 7: 35,602,584 probably null Het
Anxa6 C A 11: 55,001,282 E283* probably null Het
Bnc2 T C 4: 84,276,313 H858R possibly damaging Het
Btnl6 T C 17: 34,508,069 S496G probably benign Het
Ccdc88a T C 11: 29,460,860 S449P probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cfap43 A T 19: 47,748,017 L1345H possibly damaging Het
Cyld A T 8: 88,729,510 H396L probably benign Het
Cyp20a1 A G 1: 60,379,420 T340A possibly damaging Het
Dera A T 6: 137,830,204 I217F probably damaging Het
Dnah11 A G 12: 118,190,804 L247P probably damaging Het
Eftud2 G A 11: 102,868,621 T152M probably damaging Het
Epb41l2 C T 10: 25,443,776 T169M probably benign Het
Fam186a T C 15: 99,947,142 D407G unknown Het
Fam189a2 T C 19: 23,988,494 K214E probably damaging Het
Gli3 T A 13: 15,715,034 C578S probably damaging Het
Gm436 G A 4: 144,670,113 R350C possibly damaging Het
Gm6408 A G 5: 146,482,427 N84S probably benign Het
Herc2 C A 7: 56,188,613 T3296K probably damaging Het
Hnf4g A T 3: 3,643,073 probably benign Het
Hyal4 C A 6: 24,755,827 Q15K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcna3 A G 3: 107,036,592 E57G probably damaging Het
Kcnc3 C A 7: 44,591,596 D237E probably benign Het
Map3k8 A G 18: 4,343,137 V130A probably benign Het
Mpp7 A G 18: 7,440,430 probably null Het
Myh13 T A 11: 67,342,485 L610Q probably damaging Het
Olfr1020 T A 2: 85,849,902 M150K probably benign Het
Olfr1339 C A 4: 118,735,038 P170T probably damaging Het
Olfr917 T C 9: 38,665,768 I25M probably benign Het
Pcdhb5 A T 18: 37,321,076 T170S probably benign Het
Polr3b T A 10: 84,680,387 H626Q probably benign Het
Prkg1 A T 19: 31,764,746 L26Q probably damaging Het
Prob1 T C 18: 35,653,986 N405S possibly damaging Het
Proz T G 8: 13,073,630 S300R probably damaging Het
Psg19 A G 7: 18,794,065 I251T probably benign Het
Rcbtb1 T C 14: 59,229,952 I413T possibly damaging Het
Rnf144b T A 13: 47,228,976 Y103N probably damaging Het
Rspry1 G C 8: 94,632,119 G194R probably benign Het
Scn2b A G 9: 45,125,619 I142V probably damaging Het
Spata20 A T 11: 94,481,781 L588H probably damaging Het
Stk32b T A 5: 37,457,159 H335L probably benign Het
Taar4 A C 10: 23,960,903 D137A possibly damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tek A T 4: 94,849,837 H708L probably benign Het
Tmem89 C T 9: 108,915,027 L132F unknown Het
Ugt2b38 T C 5: 87,411,822 I404V probably benign Het
Vmn1r16 C T 6: 57,322,829 M269I probably benign Het
Vmn1r201 A G 13: 22,475,252 K212R probably damaging Het
Vmn2r11 A C 5: 109,053,760 F293V probably damaging Het
Zdhhc17 A T 10: 110,962,379 probably benign Het
Zfp423 C A 8: 87,782,710 M335I probably benign Het
Zfp74 T C 7: 29,934,654 Y543C probably damaging Het
Zfp975 A T 7: 42,662,840 S116R probably benign Het
Other mutations in Heatr5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Heatr5a APN 12 51888901 missense probably damaging 0.99
IGL01397:Heatr5a APN 12 51894369 missense possibly damaging 0.89
IGL01481:Heatr5a APN 12 51955425 missense probably damaging 1.00
IGL01684:Heatr5a APN 12 51955511 missense probably benign 0.36
IGL01766:Heatr5a APN 12 51889664 missense probably benign 0.15
IGL01799:Heatr5a APN 12 51897835 missense probably benign 0.17
IGL02007:Heatr5a APN 12 51916158 missense probably damaging 1.00
IGL02093:Heatr5a APN 12 51916075 missense possibly damaging 0.68
IGL02205:Heatr5a APN 12 51877337 missense probably damaging 1.00
IGL02450:Heatr5a APN 12 51945430 missense probably benign 0.02
IGL02565:Heatr5a APN 12 51951099 missense possibly damaging 0.54
IGL02707:Heatr5a APN 12 51921366 missense probably benign 0.01
IGL02735:Heatr5a APN 12 51915021 missense probably damaging 0.99
IGL03160:Heatr5a APN 12 51884496 splice site probably benign
F5770:Heatr5a UTSW 12 51881278 splice site probably benign
R0034:Heatr5a UTSW 12 51925172 missense probably damaging 1.00
R0127:Heatr5a UTSW 12 51925405 missense probably benign
R0184:Heatr5a UTSW 12 51909969 missense probably benign 0.00
R0362:Heatr5a UTSW 12 51888861 missense probably damaging 1.00
R0567:Heatr5a UTSW 12 51910089 missense probably damaging 1.00
R0591:Heatr5a UTSW 12 51910101 splice site probably benign
R0736:Heatr5a UTSW 12 51896561 critical splice donor site probably null
R1532:Heatr5a UTSW 12 51952518 missense probably damaging 0.99
R1914:Heatr5a UTSW 12 51905467 missense probably damaging 1.00
R1956:Heatr5a UTSW 12 51945419 critical splice donor site probably null
R1978:Heatr5a UTSW 12 51939658 missense possibly damaging 0.77
R2044:Heatr5a UTSW 12 51955403 missense probably benign 0.19
R2263:Heatr5a UTSW 12 51916150 missense probably damaging 0.97
R2265:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2267:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2268:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2269:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2842:Heatr5a UTSW 12 51955478 missense probably null 1.00
R2842:Heatr5a UTSW 12 51955477 splice site probably null
R3033:Heatr5a UTSW 12 51951038 nonsense probably null
R4303:Heatr5a UTSW 12 51956225 missense probably benign 0.01
R4675:Heatr5a UTSW 12 51877347 missense probably benign 0.17
R4718:Heatr5a UTSW 12 51916163 missense possibly damaging 0.95
R4807:Heatr5a UTSW 12 51877520 missense probably damaging 1.00
R5114:Heatr5a UTSW 12 51956237 nonsense probably null
R5229:Heatr5a UTSW 12 51947978 missense probably benign 0.33
R5411:Heatr5a UTSW 12 51888243 missense probably damaging 1.00
R5548:Heatr5a UTSW 12 51958951 nonsense probably null
R5603:Heatr5a UTSW 12 51877575 missense probably benign 0.26
R5631:Heatr5a UTSW 12 51955527 missense probably benign 0.22
R5742:Heatr5a UTSW 12 51955552 nonsense probably null
R5969:Heatr5a UTSW 12 51959040 missense probably benign
R6020:Heatr5a UTSW 12 51884327 missense probably benign 0.01
R6234:Heatr5a UTSW 12 51877454 missense possibly damaging 0.69
R6352:Heatr5a UTSW 12 51951166 missense possibly damaging 0.88
R6798:Heatr5a UTSW 12 51881265 missense probably benign 0.01
R6815:Heatr5a UTSW 12 51955508 missense possibly damaging 0.89
R7059:Heatr5a UTSW 12 51888234 missense probably damaging 0.98
R7143:Heatr5a UTSW 12 51961468 missense probably benign 0.09
R7178:Heatr5a UTSW 12 51925142 missense probably damaging 0.99
R7291:Heatr5a UTSW 12 51925339 missense probably damaging 0.97
R7454:Heatr5a UTSW 12 51961543 missense probably benign 0.20
R7511:Heatr5a UTSW 12 51879434 missense possibly damaging 0.94
R7636:Heatr5a UTSW 12 51888196 missense probably damaging 1.00
R7636:Heatr5a UTSW 12 51952558 missense probably damaging 1.00
R7665:Heatr5a UTSW 12 51961530 missense probably damaging 1.00
R8088:Heatr5a UTSW 12 51947996 missense possibly damaging 0.85
R8205:Heatr5a UTSW 12 51959009 missense probably benign 0.05
R8212:Heatr5a UTSW 12 51899229 missense probably benign 0.00
R8213:Heatr5a UTSW 12 51891443 missense probably damaging 0.96
R8323:Heatr5a UTSW 12 51955506 missense probably benign 0.02
R8326:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8339:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R8395:Heatr5a UTSW 12 51916178 missense
R8410:Heatr5a UTSW 12 51938120 missense probably benign 0.01
R8834:Heatr5a UTSW 12 51909956 critical splice donor site probably null
R8916:Heatr5a UTSW 12 51887919 critical splice donor site probably benign
R9057:Heatr5a UTSW 12 51939637 missense probably damaging 1.00
R9248:Heatr5a UTSW 12 51916243 missense
R9287:Heatr5a UTSW 12 51920477 missense probably damaging 0.97
R9332:Heatr5a UTSW 12 51899285 missense probably benign 0.33
V7732:Heatr5a UTSW 12 51905324 missense possibly damaging 0.65
Z1088:Heatr5a UTSW 12 51891404 missense probably damaging 1.00
Z1088:Heatr5a UTSW 12 51951076 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TTCTTCTAGGACAGTGGCTGGC -3'
(R):5'- AAAGCCGAAGACCCTGTTGG -3'

Sequencing Primer
(F):5'- CCCACTGTGGACTGTATATCAGG -3'
(R):5'- CCGAAGACCCTGTTGGAGGAG -3'
Posted On 2021-03-08