Incidental Mutation 'R8676:Bnc2'
ID 661369
Institutional Source Beutler Lab
Gene Symbol Bnc2
Ensembl Gene ENSMUSG00000028487
Gene Name basonuclin 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8676 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 84275095-84675275 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84276313 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 858 (H858R)
Ref Sequence ENSEMBL: ENSMUSP00000135375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102820] [ENSMUST00000107198] [ENSMUST00000176601] [ENSMUST00000176612] [ENSMUST00000176691] [ENSMUST00000176971] [ENSMUST00000176998]
AlphaFold Q8BMQ3
Predicted Effect possibly damaging
Transcript: ENSMUST00000102820
AA Change: H953R

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099884
Gene: ENSMUSG00000028487
AA Change: H953R

DomainStartEndE-ValueType
low complexity region 362 378 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
ZnF_C2H2 469 492 4.72e-2 SMART
ZnF_C2H2 497 526 7.11e0 SMART
low complexity region 612 629 N/A INTRINSIC
low complexity region 633 642 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
ZnF_C2H2 861 884 1.62e0 SMART
ZnF_C2H2 889 916 4.81e0 SMART
low complexity region 991 1008 N/A INTRINSIC
low complexity region 1048 1062 N/A INTRINSIC
ZnF_C2H2 1063 1086 1.03e-2 SMART
ZnF_C2H2 1091 1118 3.78e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107198
AA Change: H925R

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102816
Gene: ENSMUSG00000028487
AA Change: H925R

DomainStartEndE-ValueType
low complexity region 334 350 N/A INTRINSIC
low complexity region 361 372 N/A INTRINSIC
ZnF_C2H2 441 464 4.72e-2 SMART
ZnF_C2H2 469 498 7.11e0 SMART
low complexity region 584 601 N/A INTRINSIC
low complexity region 605 614 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
ZnF_C2H2 833 856 1.62e0 SMART
ZnF_C2H2 861 888 4.81e0 SMART
low complexity region 963 980 N/A INTRINSIC
low complexity region 1020 1034 N/A INTRINSIC
ZnF_C2H2 1035 1058 1.03e-2 SMART
ZnF_C2H2 1063 1090 3.78e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176601
SMART Domains Protein: ENSMUSP00000135480
Gene: ENSMUSG00000028487

DomainStartEndE-ValueType
ZnF_C2H2 12 35 1.62e0 SMART
low complexity region 53 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176612
SMART Domains Protein: ENSMUSP00000135778
Gene: ENSMUSG00000028487

DomainStartEndE-ValueType
low complexity region 292 308 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
ZnF_C2H2 399 422 4.72e-2 SMART
ZnF_C2H2 427 456 7.11e0 SMART
low complexity region 542 559 N/A INTRINSIC
low complexity region 563 572 N/A INTRINSIC
low complexity region 606 620 N/A INTRINSIC
ZnF_C2H2 791 814 1.62e0 SMART
low complexity region 832 846 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176691
AA Change: H858R

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000135375
Gene: ENSMUSG00000028487
AA Change: H858R

DomainStartEndE-ValueType
low complexity region 267 283 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
ZnF_C2H2 374 397 4.72e-2 SMART
ZnF_C2H2 402 431 7.11e0 SMART
low complexity region 517 534 N/A INTRINSIC
low complexity region 538 547 N/A INTRINSIC
low complexity region 581 595 N/A INTRINSIC
ZnF_C2H2 766 789 1.62e0 SMART
ZnF_C2H2 794 821 4.81e0 SMART
low complexity region 896 913 N/A INTRINSIC
low complexity region 953 967 N/A INTRINSIC
ZnF_C2H2 968 991 1.03e-2 SMART
ZnF_C2H2 996 1023 3.78e-1 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000134774
Gene: ENSMUSG00000028487
AA Change: H218R

DomainStartEndE-ValueType
ZnF_C2H2 105 128 1.62e0 SMART
low complexity region 146 160 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176971
AA Change: H65R

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135607
Gene: ENSMUSG00000028487
AA Change: H65R

DomainStartEndE-ValueType
ZnF_C2H2 3 28 1.98e2 SMART
low complexity region 103 120 N/A INTRINSIC
low complexity region 160 174 N/A INTRINSIC
ZnF_C2H2 175 198 1.03e-2 SMART
ZnF_C2H2 203 230 3.78e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176998
SMART Domains Protein: ENSMUSP00000135283
Gene: ENSMUSG00000028487

DomainStartEndE-ValueType
ZnF_C2H2 12 35 1.62e0 SMART
low complexity region 53 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177277
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (54/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved zinc finger protein. The encoded protein functions in skin color saturation. Mutations in this gene are associated with facial pigmented spots. This gene is also associated with susceptibility to adolescent idiopathic scoliosis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap insertion die within 24 hrs of birth and display cleft palate, an overall size reduction of the head and tongue, and abnormal craniofacial bone development due to impaired multiplication of embryonic craniofacial mesenchymal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik A G 4: 107,895,599 N152D unknown Het
1700021F05Rik A G 10: 43,532,937 L70S probably benign Het
Acsm3 T A 7: 119,775,169 S281R probably damaging Het
Adipor2 G T 6: 119,363,486 probably benign Het
Alk T C 17: 71,897,941 S1079G probably damaging Het
Ankrd27 T C 7: 35,602,584 probably null Het
Anxa6 C A 11: 55,001,282 E283* probably null Het
Btnl6 T C 17: 34,508,069 S496G probably benign Het
Ccdc88a T C 11: 29,460,860 S449P probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cfap43 A T 19: 47,748,017 L1345H possibly damaging Het
Cyld A T 8: 88,729,510 H396L probably benign Het
Cyp20a1 A G 1: 60,379,420 T340A possibly damaging Het
Dera A T 6: 137,830,204 I217F probably damaging Het
Dnah11 A G 12: 118,190,804 L247P probably damaging Het
Eftud2 G A 11: 102,868,621 T152M probably damaging Het
Epb41l2 C T 10: 25,443,776 T169M probably benign Het
Fam186a T C 15: 99,947,142 D407G unknown Het
Fam189a2 T C 19: 23,988,494 K214E probably damaging Het
Gli3 T A 13: 15,715,034 C578S probably damaging Het
Gm436 G A 4: 144,670,113 R350C possibly damaging Het
Gm6408 A G 5: 146,482,427 N84S probably benign Het
Heatr5a AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA 12: 51,887,919 probably benign Het
Herc2 C A 7: 56,188,613 T3296K probably damaging Het
Hnf4g A T 3: 3,643,073 probably benign Het
Hyal4 C A 6: 24,755,827 Q15K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcna3 A G 3: 107,036,592 E57G probably damaging Het
Kcnc3 C A 7: 44,591,596 D237E probably benign Het
Map3k8 A G 18: 4,343,137 V130A probably benign Het
Mpp7 A G 18: 7,440,430 probably null Het
Myh13 T A 11: 67,342,485 L610Q probably damaging Het
Olfr1020 T A 2: 85,849,902 M150K probably benign Het
Olfr1339 C A 4: 118,735,038 P170T probably damaging Het
Olfr917 T C 9: 38,665,768 I25M probably benign Het
Pcdhb5 A T 18: 37,321,076 T170S probably benign Het
Polr3b T A 10: 84,680,387 H626Q probably benign Het
Prkg1 A T 19: 31,764,746 L26Q probably damaging Het
Prob1 T C 18: 35,653,986 N405S possibly damaging Het
Proz T G 8: 13,073,630 S300R probably damaging Het
Psg19 A G 7: 18,794,065 I251T probably benign Het
Rcbtb1 T C 14: 59,229,952 I413T possibly damaging Het
Rnf144b T A 13: 47,228,976 Y103N probably damaging Het
Rspry1 G C 8: 94,632,119 G194R probably benign Het
Scn2b A G 9: 45,125,619 I142V probably damaging Het
Spata20 A T 11: 94,481,781 L588H probably damaging Het
Stk32b T A 5: 37,457,159 H335L probably benign Het
Taar4 A C 10: 23,960,903 D137A possibly damaging Het
Tchh CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC 3: 93,446,708 probably benign Het
Tek A T 4: 94,849,837 H708L probably benign Het
Tmem89 C T 9: 108,915,027 L132F unknown Het
Ugt2b38 T C 5: 87,411,822 I404V probably benign Het
Vmn1r16 C T 6: 57,322,829 M269I probably benign Het
Vmn1r201 A G 13: 22,475,252 K212R probably damaging Het
Vmn2r11 A C 5: 109,053,760 F293V probably damaging Het
Zdhhc17 A T 10: 110,962,379 probably benign Het
Zfp423 C A 8: 87,782,710 M335I probably benign Het
Zfp74 T C 7: 29,934,654 Y543C probably damaging Het
Zfp975 A T 7: 42,662,840 S116R probably benign Het
Other mutations in Bnc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Bnc2 APN 4 84276241 splice site probably null
IGL01902:Bnc2 APN 4 84390944 missense probably damaging 1.00
IGL02228:Bnc2 APN 4 84293076 missense possibly damaging 0.70
IGL02396:Bnc2 APN 4 84276009 missense probably benign 0.16
R0125:Bnc2 UTSW 4 84292932 missense probably damaging 1.00
R0650:Bnc2 UTSW 4 84293196 missense probably benign 0.04
R1082:Bnc2 UTSW 4 84546335 missense probably damaging 1.00
R1334:Bnc2 UTSW 4 84276289 missense possibly damaging 0.49
R1439:Bnc2 UTSW 4 84276068 missense probably benign 0.38
R1447:Bnc2 UTSW 4 84293220 missense probably benign 0.13
R1515:Bnc2 UTSW 4 84414326 missense probably null 0.99
R1548:Bnc2 UTSW 4 84275957 missense probably damaging 1.00
R1818:Bnc2 UTSW 4 84291874 missense possibly damaging 0.70
R1819:Bnc2 UTSW 4 84291874 missense possibly damaging 0.70
R2345:Bnc2 UTSW 4 84292503 missense probably damaging 1.00
R2897:Bnc2 UTSW 4 84292915 missense probably damaging 1.00
R2898:Bnc2 UTSW 4 84292915 missense probably damaging 1.00
R2966:Bnc2 UTSW 4 84293517 missense probably benign 0.14
R3404:Bnc2 UTSW 4 84546241 missense probably damaging 0.98
R4235:Bnc2 UTSW 4 84293514 missense probably damaging 0.96
R4546:Bnc2 UTSW 4 84291976 missense probably benign 0.34
R4676:Bnc2 UTSW 4 84292819 missense probably damaging 1.00
R4926:Bnc2 UTSW 4 84276179 missense probably damaging 1.00
R5060:Bnc2 UTSW 4 84531635 missense probably benign 0.02
R5365:Bnc2 UTSW 4 84411429 intron probably benign
R5735:Bnc2 UTSW 4 84292671 missense probably damaging 1.00
R5872:Bnc2 UTSW 4 84292770 missense possibly damaging 0.86
R5921:Bnc2 UTSW 4 84293055 missense possibly damaging 0.95
R5999:Bnc2 UTSW 4 84555900 missense probably benign 0.20
R6351:Bnc2 UTSW 4 84293143 missense probably benign 0.16
R6869:Bnc2 UTSW 4 84293496 missense probably damaging 1.00
R7236:Bnc2 UTSW 4 84555864 missense probably benign 0.31
R7363:Bnc2 UTSW 4 84292071 missense probably benign 0.02
R7643:Bnc2 UTSW 4 84506574 missense probably benign 0.01
R8017:Bnc2 UTSW 4 84411425 missense
R8019:Bnc2 UTSW 4 84411425 missense
R8050:Bnc2 UTSW 4 84292336 missense probably benign 0.00
R8311:Bnc2 UTSW 4 84276345 missense possibly damaging 0.69
R8463:Bnc2 UTSW 4 84293371 missense probably damaging 0.99
R8722:Bnc2 UTSW 4 84293646 missense possibly damaging 0.92
R8845:Bnc2 UTSW 4 84276101 missense possibly damaging 0.81
R8887:Bnc2 UTSW 4 84291470 intron probably benign
R9051:Bnc2 UTSW 4 84291901 missense probably benign 0.00
R9142:Bnc2 UTSW 4 84555874 missense probably benign 0.03
R9165:Bnc2 UTSW 4 84411494 missense
X0021:Bnc2 UTSW 4 84293140 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGGACTCTCTGGAGGAATG -3'
(R):5'- ACTCCCAGATCCTGAGGATG -3'

Sequencing Primer
(F):5'- CTCTCTGGAGGAATGGACACTG -3'
(R):5'- ATGGTGTAATTAGGAATGAATGTGC -3'
Posted On 2021-03-08