Incidental Mutation 'R8713:Scube1'
ID 669734
Institutional Source Beutler Lab
Gene Symbol Scube1
Ensembl Gene ENSMUSG00000016763
Gene Name signal peptide, CUB domain, EGF-like 1
Synonyms 7330410C13Rik, A630023E24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock # R8713 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 83604999-83725021 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 83610270 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 852 (A852E)
Ref Sequence ENSEMBL: ENSMUSP00000016907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016907] [ENSMUST00000043634] [ENSMUST00000076060] [ENSMUST00000171496]
AlphaFold Q6NZL8
Predicted Effect possibly damaging
Transcript: ENSMUST00000016907
AA Change: A852E

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000016907
Gene: ENSMUSG00000016763
AA Change: A852E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 165 203 1.43e-1 SMART
EGF 205 242 1.09e1 SMART
EGF 274 311 1.69e-3 SMART
EGF_CA 312 352 2.13e-9 SMART
EGF_CA 353 391 4.7e-11 SMART
EGF_CA 392 432 3.91e-8 SMART
low complexity region 560 573 N/A INTRINSIC
Pfam:GCC2_GCC3 666 713 4.5e-13 PFAM
EGF_like 766 804 6.81e1 SMART
CUB 828 940 1.51e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000043634
AA Change: A741E

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044835
Gene: ENSMUSG00000016763
AA Change: A741E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 163 200 1.69e-3 SMART
EGF_CA 201 241 2.13e-9 SMART
EGF_CA 242 280 4.7e-11 SMART
EGF_CA 281 321 3.91e-8 SMART
low complexity region 449 462 N/A INTRINSIC
Pfam:GCC2_GCC3 555 602 3.2e-11 PFAM
EGF_like 655 693 6.81e1 SMART
CUB 717 829 1.51e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000076060
AA Change: A822E

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000075434
Gene: ENSMUSG00000016763
AA Change: A822E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 165 203 1.43e-1 SMART
EGF 205 242 1.09e1 SMART
EGF 244 281 1.69e-3 SMART
EGF_CA 282 322 2.13e-9 SMART
EGF_CA 323 361 4.7e-11 SMART
EGF_CA 362 402 3.91e-8 SMART
low complexity region 530 543 N/A INTRINSIC
Pfam:GCC2_GCC3 636 683 1.3e-11 PFAM
EGF_like 736 774 6.81e1 SMART
CUB 798 910 1.51e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171496
AA Change: A822E

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130131
Gene: ENSMUSG00000016763
AA Change: A822E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 165 203 1.43e-1 SMART
EGF 205 242 1.09e1 SMART
EGF 244 281 1.69e-3 SMART
EGF_CA 282 322 2.13e-9 SMART
EGF_CA 323 361 4.7e-11 SMART
EGF_CA 362 402 3.91e-8 SMART
low complexity region 530 543 N/A INTRINSIC
Pfam:GCC2_GCC3 636 683 1.7e-11 PFAM
EGF_like 736 774 6.81e1 SMART
CUB 798 910 1.51e-19 SMART
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface glycoprotein that is a member of the SCUBE (signal peptide, CUB domain, EGF (epidermal growth factor)-like protein) family. Family members have an amino-terminal signal peptide, nine copies of EGF-like repeats and a CUB domain at the carboxyl terminus. This protein is expressed in platelets and endothelial cells and may play an important role in vascular biology. [provided by RefSeq, Oct 2011]
PHENOTYPE: A fraction of homozygotes die neonatally with acrania and loss of brain tissue. Early skull bone defects include lack of the interparietal and supraoccipital bones and cranial vault. Affected mutant embryos show exencephaly, a thick-walled forebrain neuroepithelium and hyperplastic cranial ganglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 C T 5: 35,873,174 A581V possibly damaging Het
Adam18 T A 8: 24,652,173 M196L probably benign Het
Ankrd10 A G 8: 11,628,491 S134P probably damaging Het
Ano8 C T 8: 71,485,077 G47D probably damaging Het
Arl6ip4 T C 5: 124,116,762 V4A unknown Het
Cabp4 C T 19: 4,136,160 M247I probably benign Het
Ccdc30 A T 4: 119,404,207 L11Q probably damaging Het
Cdkl4 A G 17: 80,533,863 S288P possibly damaging Het
Celsr3 A G 9: 108,829,863 I1182V probably benign Het
Dnah17 T C 11: 118,088,202 D1788G probably damaging Het
Dsp A G 13: 38,168,725 D193G probably damaging Het
Dym T G 18: 75,056,738 Y132* probably null Het
Dync2h1 G A 9: 7,141,008 Q1340* probably null Het
Elmo1 T C 13: 20,274,621 probably benign Het
Fbxw15 A C 9: 109,555,599 F378V possibly damaging Het
Fsip2 G A 2: 82,981,109 G2591R probably damaging Het
Gps2 C A 11: 69,915,354 D148E probably benign Het
Iars2 T C 1: 185,291,418 D772G possibly damaging Het
Ifit1 T A 19: 34,647,638 L58Q probably benign Het
Kctd4 A T 14: 75,962,926 Q112H probably benign Het
Letm1 A G 5: 33,762,505 L230P probably damaging Het
Lrch4 G T 5: 137,639,863 E136* probably null Het
Macc1 T C 12: 119,443,526 probably benign Het
Macrod1 T C 19: 7,057,126 L79P probably benign Het
Map2 T A 1: 66,414,622 N890K probably damaging Het
Mctp1 G A 13: 76,641,803 S270N probably benign Het
Mrpl44 C T 1: 79,777,991 R105C probably damaging Het
Mtg1 T A 7: 140,137,775 probably null Het
Mtg1 T C 7: 140,140,223 F68L probably benign Het
Nfil3 A G 13: 52,968,011 S286P possibly damaging Het
Nutm1 A G 2: 112,251,322 V332A possibly damaging Het
Obscn T A 11: 59,135,966 Q137L probably benign Het
Pcnx2 T G 8: 125,818,786 E1162A probably damaging Het
Pgr A G 9: 8,900,817 D117G possibly damaging Het
Plce1 T C 19: 38,524,901 C215R probably benign Het
Rrm1 T G 7: 102,460,351 Y461D probably damaging Het
Sbk3 C T 7: 4,969,992 V60I possibly damaging Het
Sec24d T A 3: 123,343,892 I561N probably damaging Het
Slc16a4 T C 3: 107,311,585 *501Q probably null Het
Slc6a19 C A 13: 73,700,621 V5L probably benign Het
Spryd3 A G 15: 102,133,485 I34T possibly damaging Het
Syne1 A G 10: 5,316,040 L2191P probably damaging Het
Tbrg1 A G 9: 37,652,659 C227R probably damaging Het
Tdrd6 A G 17: 43,625,019 S1713P probably benign Het
Thap12 C T 7: 98,707,076 L57F probably benign Het
Top1 G A 2: 160,717,440 V628I probably damaging Het
Trim67 A G 8: 124,820,335 M495V probably null Het
Trio A C 15: 27,743,951 probably benign Het
Vmn2r23 A T 6: 123,703,032 Y71F Het
Ywhah A G 5: 33,027,191 N246S probably benign Het
Zcwpw1 T C 5: 137,799,532 I125T probably benign Het
Other mutations in Scube1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Scube1 APN 15 83703501 missense probably damaging 0.98
IGL01152:Scube1 APN 15 83613570 missense probably damaging 1.00
IGL01388:Scube1 APN 15 83620131 missense probably benign 0.00
IGL01589:Scube1 APN 15 83612553 missense probably damaging 1.00
IGL02208:Scube1 APN 15 83703540 missense probably damaging 1.00
IGL02305:Scube1 APN 15 83607390 missense probably damaging 1.00
IGL02728:Scube1 APN 15 83659016 splice site probably benign
IGL02737:Scube1 APN 15 83721843 splice site probably benign
IGL03326:Scube1 APN 15 83607416 missense probably damaging 1.00
R0055:Scube1 UTSW 15 83634736 missense probably damaging 1.00
R0055:Scube1 UTSW 15 83634736 missense probably damaging 1.00
R0126:Scube1 UTSW 15 83621063 missense probably damaging 1.00
R0792:Scube1 UTSW 15 83628076 critical splice acceptor site probably null
R1438:Scube1 UTSW 15 83615026 missense possibly damaging 0.93
R1522:Scube1 UTSW 15 83628076 critical splice acceptor site probably null
R1735:Scube1 UTSW 15 83607437 missense probably damaging 1.00
R1766:Scube1 UTSW 15 83721945 missense probably damaging 1.00
R1778:Scube1 UTSW 15 83610204 missense probably damaging 1.00
R2975:Scube1 UTSW 15 83659098 missense probably damaging 0.99
R4080:Scube1 UTSW 15 83608747 missense probably damaging 1.00
R4434:Scube1 UTSW 15 83721924 missense probably damaging 1.00
R5585:Scube1 UTSW 15 83676923 missense probably damaging 1.00
R5857:Scube1 UTSW 15 83607260 unclassified probably benign
R5977:Scube1 UTSW 15 83629488 missense probably damaging 1.00
R6054:Scube1 UTSW 15 83651676 missense probably benign 0.43
R6461:Scube1 UTSW 15 83612427 missense probably damaging 1.00
R6956:Scube1 UTSW 15 83721876 missense probably damaging 1.00
R6959:Scube1 UTSW 15 83629435 missense probably benign 0.42
R7124:Scube1 UTSW 15 83629511 splice site probably null
R7267:Scube1 UTSW 15 83621065 missense probably damaging 1.00
R7404:Scube1 UTSW 15 83615010 missense probably damaging 0.98
R7584:Scube1 UTSW 15 83721887 nonsense probably null
R7585:Scube1 UTSW 15 83638787 missense possibly damaging 0.83
R7599:Scube1 UTSW 15 83613452 missense probably damaging 1.00
R8055:Scube1 UTSW 15 83659025 critical splice donor site probably null
R8098:Scube1 UTSW 15 83659088 missense probably damaging 1.00
R8192:Scube1 UTSW 15 83629382 critical splice donor site probably null
R8394:Scube1 UTSW 15 83608291 missense probably damaging 1.00
R8441:Scube1 UTSW 15 83610222 missense probably damaging 0.99
R8844:Scube1 UTSW 15 83676963 missense probably damaging 1.00
R9090:Scube1 UTSW 15 83610193 missense probably damaging 1.00
R9169:Scube1 UTSW 15 83659097 missense possibly damaging 0.88
R9271:Scube1 UTSW 15 83610193 missense probably damaging 1.00
R9334:Scube1 UTSW 15 83628063 missense possibly damaging 0.72
R9363:Scube1 UTSW 15 83614879 nonsense probably null
X0022:Scube1 UTSW 15 83634669 critical splice donor site probably null
Z1177:Scube1 UTSW 15 83612416 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TATCCTACCTCGTGGGGACTTC -3'
(R):5'- TAGCACGAGGCCTCAATAGC -3'

Sequencing Primer
(F):5'- GGAGTCACCCACTTTCTGAG -3'
(R):5'- AGGCCTCAATAGCTGGCAC -3'
Posted On 2021-04-30