Mutagenetix > Incidental Mutation

Incidental Mutation 'R6956:Scube1'

541479

Institutional Source

Beutler Lab

Gene Symbol

Scube1

Ensembl Gene

ENSMUSG00000016763

Gene Name

signal peptide, CUB domain, EGF-like 1

Synonyms

7330410C13Rik, A630023E24Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R6956 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83604999-83725021 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 83721876 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 65 (Y65C)

Ref Sequence

ENSEMBL: ENSMUSP00000130131 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016907] [ENSMUST00000043634] [ENSMUST00000076060] [ENSMUST00000171496]

AlphaFold

Q6NZL8

Predicted Effect

probably damaging
Transcript: ENSMUST00000016907
AA Change: Y65C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000016907
Gene: ENSMUSG00000016763
AA Change: Y65C

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF_CA	33	73	1.5e-9	SMART
EGF_CA	74	116	7.29e-8	SMART
EGF_CA	117	157	1.4e-9	SMART
EGF	165	203	1.43e-1	SMART
EGF	205	242	1.09e1	SMART
EGF	274	311	1.69e-3	SMART
EGF_CA	312	352	2.13e-9	SMART
EGF_CA	353	391	4.7e-11	SMART
EGF_CA	392	432	3.91e-8	SMART
low complexity region	560	573	N/A	INTRINSIC
Pfam:GCC2_GCC3	666	713	4.5e-13	PFAM
EGF_like	766	804	6.81e1	SMART
CUB	828	940	1.51e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000043634
AA Change: Y65C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044835
Gene: ENSMUSG00000016763
AA Change: Y65C

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF_CA	33	73	1.5e-9	SMART
EGF_CA	74	116	7.29e-8	SMART
EGF_CA	117	157	1.4e-9	SMART
EGF	163	200	1.69e-3	SMART
EGF_CA	201	241	2.13e-9	SMART
EGF_CA	242	280	4.7e-11	SMART
EGF_CA	281	321	3.91e-8	SMART
low complexity region	449	462	N/A	INTRINSIC
Pfam:GCC2_GCC3	555	602	3.2e-11	PFAM
EGF_like	655	693	6.81e1	SMART
CUB	717	829	1.51e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000076060
AA Change: Y65C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000075434
Gene: ENSMUSG00000016763
AA Change: Y65C

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF_CA	33	73	1.5e-9	SMART
EGF_CA	74	116	7.29e-8	SMART
EGF_CA	117	157	1.4e-9	SMART
EGF	165	203	1.43e-1	SMART
EGF	205	242	1.09e1	SMART
EGF	244	281	1.69e-3	SMART
EGF_CA	282	322	2.13e-9	SMART
EGF_CA	323	361	4.7e-11	SMART
EGF_CA	362	402	3.91e-8	SMART
low complexity region	530	543	N/A	INTRINSIC
Pfam:GCC2_GCC3	636	683	1.3e-11	PFAM
EGF_like	736	774	6.81e1	SMART
CUB	798	910	1.51e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000171496
AA Change: Y65C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130131
Gene: ENSMUSG00000016763
AA Change: Y65C

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF_CA	33	73	1.5e-9	SMART
EGF_CA	74	116	7.29e-8	SMART
EGF_CA	117	157	1.4e-9	SMART
EGF	165	203	1.43e-1	SMART
EGF	205	242	1.09e1	SMART
EGF	244	281	1.69e-3	SMART
EGF_CA	282	322	2.13e-9	SMART
EGF_CA	323	361	4.7e-11	SMART
EGF_CA	362	402	3.91e-8	SMART
low complexity region	530	543	N/A	INTRINSIC
Pfam:GCC2_GCC3	636	683	1.7e-11	PFAM
EGF_like	736	774	6.81e1	SMART
CUB	798	910	1.51e-19	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.7%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface glycoprotein that is a member of the SCUBE (signal peptide, CUB domain, EGF (epidermal growth factor)-like protein) family. Family members have an amino-terminal signal peptide, nine copies of EGF-like repeats and a CUB domain at the carboxyl terminus. This protein is expressed in platelets and endothelial cells and may play an important role in vascular biology. [provided by RefSeq, Oct 2011]
PHENOTYPE: A fraction of homozygotes die neonatally with acrania and loss of brain tissue. Early skull bone defects include lack of the interparietal and supraoccipital bones and cranial vault. Affected mutant embryos show exencephaly, a thick-walled forebrain neuroepithelium and hyperplastic cranial ganglia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921530L21Rik	T	A	14: 95,882,433	W209R	probably damaging	Het
Aars	G	A	8: 111,055,130	V945M	probably benign	Het
Amotl2	A	G	9: 102,724,768	T371A	probably damaging	Het
Bmpr1a	A	G	14: 34,441,175	I86T	possibly damaging	Het
C9	A	T	15: 6,445,464	M35L	probably benign	Het
Cc2d1a	G	T	8: 84,135,899	P661T	probably damaging	Het
Dcdc2a	T	A	13: 25,119,366	S293R	probably benign	Het
Dchs2	T	A	3: 83,353,926	N2500K	probably benign	Het
Dicer1	A	G	12: 104,731,023	S92P	probably damaging	Het
Dnah7a	T	A	1: 53,577,287	I1172F	probably benign	Het
Dnajc6	A	G	4: 101,614,273	S364G	probably damaging	Het
Dpp6	A	T	5: 27,598,821	N255I	probably damaging	Het
Eif2ak4	T	C	2: 118,422,267	I440T	probably damaging	Het
Fam155a	T	A	8: 9,770,744	Q92L	probably benign	Het
Fam184b	T	C	5: 45,530,757	T937A	probably damaging	Het
Fam229b	T	A	10: 39,133,847		probably null	Het
Gbp11	A	G	5: 105,328,375		probably null	Het
Gipc2	A	G	3: 152,094,248	F282L	probably benign	Het
Gm4858	T	C	3: 93,073,972	V25A	possibly damaging	Het
Gpt2	G	A	8: 85,518,052	E325K	probably benign	Het
H2-T3	T	A	17: 36,189,371	Y144F	probably damaging	Het
Kel	T	G	6: 41,687,973	D7A	probably damaging	Het
Lrrc7	A	G	3: 158,289,031	V166A	probably benign	Het
Mapt	T	C	11: 104,318,255		probably null	Het
March3	A	G	18: 56,775,981	V244A	probably benign	Het
Mboat1	T	C	13: 30,238,076	V396A	possibly damaging	Het
Mphosph9	T	C	5: 124,297,558	D604G	probably damaging	Het
Muc16	T	C	9: 18,645,026	T3324A	unknown	Het
Nat10	T	C	2: 103,734,412	I495V	probably benign	Het
Olfr784	A	T	10: 129,388,297	K221N	probably benign	Het
Pfkfb2	T	C	1: 130,707,600	N75D	probably damaging	Het
Psmd3	T	A	11: 98,695,551	L515Q	probably damaging	Het
Rpgrip1l	A	C	8: 91,286,313		probably null	Het
Slc12a4	A	G	8: 105,953,852	F211L	probably damaging	Het
Socs7	T	C	11: 97,377,023	S327P	probably benign	Het
Spef2	A	T	15: 9,684,935	D591E	probably damaging	Het
Sult2a6	T	A	7: 14,254,823	D4V	possibly damaging	Het
Tdrd9	A	G	12: 112,036,354		probably benign	Het
Tgm4	G	T	9: 123,064,703	M155I	possibly damaging	Het
Togaram2	T	C	17: 71,729,188	V891A	probably benign	Het
Usp1	A	G	4: 98,931,006	E235G	probably damaging	Het
Usp2	T	A	9: 44,092,756	V533E	probably damaging	Het
Vcan	T	A	13: 89,689,431	I2665F	probably damaging	Het
Vmn2r31	G	A	7: 7,394,506	S251L	probably benign	Het
Vmn2r84	C	A	10: 130,389,267	C458F	probably damaging	Het

Other mutations in Scube1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00903:Scube1	APN	15	83703501	missense	probably damaging	0.98
IGL01152:Scube1	APN	15	83613570	missense	probably damaging	1.00
IGL01388:Scube1	APN	15	83620131	missense	probably benign	0.00
IGL01589:Scube1	APN	15	83612553	missense	probably damaging	1.00
IGL02208:Scube1	APN	15	83703540	missense	probably damaging	1.00
IGL02305:Scube1	APN	15	83607390	missense	probably damaging	1.00
IGL02728:Scube1	APN	15	83659016	splice site	probably benign
IGL02737:Scube1	APN	15	83721843	splice site	probably benign
IGL03326:Scube1	APN	15	83607416	missense	probably damaging	1.00
R0055:Scube1	UTSW	15	83634736	missense	probably damaging	1.00
R0055:Scube1	UTSW	15	83634736	missense	probably damaging	1.00
R0126:Scube1	UTSW	15	83621063	missense	probably damaging	1.00
R0792:Scube1	UTSW	15	83628076	critical splice acceptor site	probably null
R1438:Scube1	UTSW	15	83615026	missense	possibly damaging	0.93
R1522:Scube1	UTSW	15	83628076	critical splice acceptor site	probably null
R1735:Scube1	UTSW	15	83607437	missense	probably damaging	1.00
R1766:Scube1	UTSW	15	83721945	missense	probably damaging	1.00
R1778:Scube1	UTSW	15	83610204	missense	probably damaging	1.00
R2975:Scube1	UTSW	15	83659098	missense	probably damaging	0.99
R4080:Scube1	UTSW	15	83608747	missense	probably damaging	1.00
R4434:Scube1	UTSW	15	83721924	missense	probably damaging	1.00
R5585:Scube1	UTSW	15	83676923	missense	probably damaging	1.00
R5857:Scube1	UTSW	15	83607260	unclassified	probably benign
R5977:Scube1	UTSW	15	83629488	missense	probably damaging	1.00
R6054:Scube1	UTSW	15	83651676	missense	probably benign	0.43
R6461:Scube1	UTSW	15	83612427	missense	probably damaging	1.00
R6959:Scube1	UTSW	15	83629435	missense	probably benign	0.42
R7124:Scube1	UTSW	15	83629511	splice site	probably null
R7267:Scube1	UTSW	15	83621065	missense	probably damaging	1.00
R7404:Scube1	UTSW	15	83615010	missense	probably damaging	0.98
R7584:Scube1	UTSW	15	83721887	nonsense	probably null
R7585:Scube1	UTSW	15	83638787	missense	possibly damaging	0.83
R7599:Scube1	UTSW	15	83613452	missense	probably damaging	1.00
R8055:Scube1	UTSW	15	83659025	critical splice donor site	probably null
R8098:Scube1	UTSW	15	83659088	missense	probably damaging	1.00
R8192:Scube1	UTSW	15	83629382	critical splice donor site	probably null
R8394:Scube1	UTSW	15	83608291	missense	probably damaging	1.00
R8441:Scube1	UTSW	15	83610222	missense	probably damaging	0.99
R8713:Scube1	UTSW	15	83610270	missense	possibly damaging	0.58
R8844:Scube1	UTSW	15	83676963	missense	probably damaging	1.00
R9090:Scube1	UTSW	15	83610193	missense	probably damaging	1.00
R9169:Scube1	UTSW	15	83659097	missense	possibly damaging	0.88
R9271:Scube1	UTSW	15	83610193	missense	probably damaging	1.00
R9334:Scube1	UTSW	15	83628063	missense	possibly damaging	0.72
R9363:Scube1	UTSW	15	83614879	nonsense	probably null
R9534:Scube1	UTSW	15	83721901	missense	probably damaging	1.00
R9569:Scube1	UTSW	15	83629404	missense	probably damaging	1.00
R9574:Scube1	UTSW	15	83616799	missense
R9759:Scube1	UTSW	15	83608264	missense	probably benign	0.02
R9788:Scube1	UTSW	15	83651700	missense	possibly damaging	0.73
X0022:Scube1	UTSW	15	83634669	critical splice donor site	probably null
Z1177:Scube1	UTSW	15	83612416	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCAGCCTATGTCTCCTGAAAAG -3'
(R):5'- CGTTAATGTTGGCTCTCCCAG -3'

Sequencing Primer
(F):5'- TATGTCTCCTGAAAAGCCTGCAGG -3'
(R):5'- AATGTTGGCTCTCCCAGTGGTC -3'

Posted On

2018-11-28