Incidental Mutation 'R8792:Dnah14'
ID 670972
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Name dynein, axonemal, heavy chain 14
Synonyms Dnahc14, Gm980, LOC381311, A230079K17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R8792 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 181576559-181815774 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 181814624 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 102 (T102S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005003] [ENSMUST00000208001]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000005003
SMART Domains Protein: ENSMUSP00000005003
Gene: ENSMUSG00000004880

TUDOR 4 62 6.7e-9 SMART
low complexity region 63 101 N/A INTRINSIC
low complexity region 111 121 N/A INTRINSIC
Pfam:ERG4_ERG24 194 626 4.6e-161 PFAM
Pfam:DUF1295 452 617 1.1e-9 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000195458
Predicted Effect probably benign
Transcript: ENSMUST00000208001
AA Change: T4459S

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0666 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco2 T C 15: 81,909,496 I382T probably damaging Het
Adam39 G T 8: 40,826,576 R668L probably benign Het
Adam6b T C 12: 113,491,690 I709T possibly damaging Het
Adgrl3 A G 5: 81,688,675 E692G probably damaging Het
Asxl2 T C 12: 3,496,536 L440P probably benign Het
Bmf A G 2: 118,546,905 F121L probably damaging Het
Cdk9 A T 2: 32,708,257 F262L probably benign Het
Clock T A 5: 76,262,727 D99V probably damaging Het
Eps15 T C 4: 109,305,711 V67A probably benign Het
Fam171b T A 2: 83,812,759 L4H probably damaging Het
Fam214b G A 4: 43,033,546 P536S probably damaging Het
Fam71d C T 12: 78,715,150 T196M probably damaging Het
Fcho2 T A 13: 98,815,261 probably benign Het
Gal3st4 C T 5: 138,270,989 V70M probably damaging Het
Gif C A 19: 11,750,235 A141E probably damaging Het
Got1l1 C A 8: 27,200,721 probably null Het
Gpr146 A G 5: 139,392,794 Y117C probably damaging Het
Gpr158 G A 2: 21,553,326 V346M probably damaging Het
Herc1 C A 9: 66,465,486 P3108Q probably damaging Het
Hoxc9 A G 15: 102,981,794 S48G probably benign Het
I830077J02Rik T C 3: 105,927,788 probably benign Het
Lama4 T G 10: 39,048,052 I485M probably benign Het
Lrp4 C T 2: 91,494,955 T1375I possibly damaging Het
Lrp6 T C 6: 134,486,586 Y544C probably damaging Het
Man2b1 C T 8: 85,095,144 Q692* probably null Het
Mark2 G T 19: 7,281,215 H570N probably benign Het
Mlph T C 1: 90,942,960 probably benign Het
Mnx1 G A 5: 29,478,374 probably benign Het
Nkx2-2 A T 2: 147,177,893 V208E probably benign Het
Nlrp1b T C 11: 71,160,093 I1058V probably benign Het
Nwd2 T C 5: 63,805,704 I877T probably damaging Het
Olfml2b A T 1: 170,681,100 N509I possibly damaging Het
Olfr1226 T C 2: 89,193,887 Y49C probably benign Het
Olfr1307 G C 2: 111,944,728 H243D probably damaging Het
Olfr387-ps1 T C 11: 73,664,645 L12P probably damaging Het
Pabpc6 T C 17: 9,669,403 N73S probably damaging Het
Parp12 A G 6: 39,089,050 F580L probably benign Het
Parvg C A 15: 84,328,959 H80Q probably damaging Het
Pcdhb14 T C 18: 37,449,488 V549A probably damaging Het
Pde8b T A 13: 95,043,026 H374L probably benign Het
Phf2 C T 13: 48,817,505 probably benign Het
Pld4 T C 12: 112,763,490 F69L probably benign Het
Qrich2 T C 11: 116,456,630 I1123V unknown Het
Rida C T 15: 34,495,096 V8M possibly damaging Het
Rnf19b T A 4: 129,058,685 C139S probably damaging Het
Rp1 T C 1: 4,024,868 I1254M unknown Het
Rpl3l A G 17: 24,728,473 T2A possibly damaging Het
Serpinb6e A T 13: 33,838,959 I147N possibly damaging Het
Slc12a4 G A 8: 105,946,758 T727I probably damaging Het
Slc25a16 C T 10: 62,928,340 R59* probably null Het
Strc T A 2: 121,377,805 I362F probably damaging Het
Tbc1d5 TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 17: 50,799,934 probably benign Het
Tll1 T A 8: 64,085,465 T382S probably damaging Het
Tmem246 T C 4: 49,587,067 T34A possibly damaging Het
Tmprss6 T A 15: 78,444,128 D556V probably damaging Het
Ttc13 A G 8: 124,674,360 probably null Het
Ttc30a1 C A 2: 75,981,554 E62* probably null Het
Usp43 T A 11: 67,876,418 K709* probably null Het
Vcan A T 13: 89,692,111 N1771K possibly damaging Het
Zfyve16 T C 13: 92,523,161 I81V probably benign Het
Zxdc A G 6: 90,370,004 T116A probably benign Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181752046 missense probably benign 0.17
IGL01764:Dnah14 APN 1 181744777 missense probably benign 0.00
IGL03218:Dnah14 APN 1 181755269 missense probably benign 0.02
IGL03290:Dnah14 APN 1 181763978 splice site probably benign
IGL03384:Dnah14 APN 1 181745949 missense probably benign 0.03
R0009:Dnah14 UTSW 1 181769407 splice site probably benign
R0125:Dnah14 UTSW 1 181752063 missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181744747 missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181750177 missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181763960 missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181752562 missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181755241 critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181757223 missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181757234 missense probably benign 0.01
R5424:Dnah14 UTSW 1 181763310 missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181741159 missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181770105 missense probably benign 0.00
R6052:Dnah14 UTSW 1 181666487 missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181709051 missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181750154 missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181621833 missense probably benign 0.13
R6145:Dnah14 UTSW 1 181666417 missense probably benign 0.00
R6163:Dnah14 UTSW 1 181666361 missense probably benign 0.33
R6246:Dnah14 UTSW 1 181680888 missense probably benign 0.00
R6302:Dnah14 UTSW 1 181601206 missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181585024 frame shift probably null
R6326:Dnah14 UTSW 1 181783556 missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181626720 missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181755386 splice site probably null
R6376:Dnah14 UTSW 1 181605894 missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181651202 critical splice donor site probably null
R6433:Dnah14 UTSW 1 181651657 missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181783705 missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181744768 missense probably benign 0.26
R6523:Dnah14 UTSW 1 181643621 missense probably benign 0.00
R6529:Dnah14 UTSW 1 181666469 missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181584985 missense unknown
R6546:Dnah14 UTSW 1 181738987 missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181593452 missense probably benign 0.07
R6762:Dnah14 UTSW 1 181757259 missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181641405 missense probably benign 0.21
R6849:Dnah14 UTSW 1 181808945 missense probably benign 0.00
R6877:Dnah14 UTSW 1 181628432 missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181750183 missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181585066 missense probably benign 0.04
R6924:Dnah14 UTSW 1 181627952 missense probably benign 0.04
R6957:Dnah14 UTSW 1 181785175 missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181648230 missense probably benign 0.00
R7018:Dnah14 UTSW 1 181626944 missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181623003 missense probably benign 0.01
R7058:Dnah14 UTSW 1 181698049 missense probably benign 0.00
R7068:Dnah14 UTSW 1 181769790 missense probably benign 0.35
R7115:Dnah14 UTSW 1 181720145 missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181745958 nonsense probably null
R7165:Dnah14 UTSW 1 181704535 missense probably benign 0.00
R7169:Dnah14 UTSW 1 181702365 missense probably benign 0.00
R7184:Dnah14 UTSW 1 181704529 nonsense probably null
R7232:Dnah14 UTSW 1 181757363 missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181706744 missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181685807 missense probably benign 0.41
R7290:Dnah14 UTSW 1 181628174 missense probably benign 0.20
R7314:Dnah14 UTSW 1 181785254 splice site probably null
R7326:Dnah14 UTSW 1 181598403 missense probably benign 0.02
R7336:Dnah14 UTSW 1 181797734 missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181690524 splice site probably null
R7371:Dnah14 UTSW 1 181626885 missense probably benign 0.05
R7376:Dnah14 UTSW 1 181763402 missense probably benign 0.03
R7418:Dnah14 UTSW 1 181616742 missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181752139 missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181628067 missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181770054 missense probably benign 0.26
R7641:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7663:Dnah14 UTSW 1 181752155 splice site probably null
R7674:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7680:Dnah14 UTSW 1 181685800 missense probably benign 0.15
R7709:Dnah14 UTSW 1 181702484 critical splice donor site probably null
R7842:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181616759 missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181783574 missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181648311 missense probably benign 0.05
R8042:Dnah14 UTSW 1 181643631 critical splice donor site probably null
R8071:Dnah14 UTSW 1 181615894 missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181766232 missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181806032 nonsense probably null
R8139:Dnah14 UTSW 1 181755288 missense probably damaging 1.00
R8176:Dnah14 UTSW 1 181657033 missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181688205 missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181690101 missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181795545 missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181795545 missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181664865 missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181744792 missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181773811 missense probably benign 0.03
R8289:Dnah14 UTSW 1 181716215 nonsense probably null
R8323:Dnah14 UTSW 1 181704544 missense probably benign 0.01
R8442:Dnah14 UTSW 1 181741284 missense probably damaging 0.97
R8458:Dnah14 UTSW 1 181806012 missense
R8507:Dnah14 UTSW 1 181641414 missense probably benign 0.02
R8509:Dnah14 UTSW 1 181814655 missense
R8520:Dnah14 UTSW 1 181653638 missense probably damaging 1.00
R8530:Dnah14 UTSW 1 181664946 missense probably damaging 1.00
R8703:Dnah14 UTSW 1 181666011 nonsense probably null
R8710:Dnah14 UTSW 1 181690311 missense probably benign 0.04
R8752:Dnah14 UTSW 1 181628016 missense probably benign 0.00
R8797:Dnah14 UTSW 1 181637847 missense probably benign 0.19
R8821:Dnah14 UTSW 1 181792004 nonsense probably null
R8834:Dnah14 UTSW 1 181616750 missense possibly damaging 0.83
R8913:Dnah14 UTSW 1 181725498 missense probably benign 0.01
R8925:Dnah14 UTSW 1 181680756 missense probably damaging 1.00
R8927:Dnah14 UTSW 1 181680756 missense probably damaging 1.00
R8934:Dnah14 UTSW 1 181622723 missense possibly damaging 0.84
R9090:Dnah14 UTSW 1 181769760 missense probably benign 0.33
R9169:Dnah14 UTSW 1 181605816 missense probably benign 0.06
R9199:Dnah14 UTSW 1 181651001 missense possibly damaging 0.50
R9212:Dnah14 UTSW 1 181801287 missense possibly damaging 0.95
R9213:Dnah14 UTSW 1 181616640 critical splice donor site probably null
R9271:Dnah14 UTSW 1 181769760 missense probably benign 0.33
R9282:Dnah14 UTSW 1 181814512 missense
R9350:Dnah14 UTSW 1 181734804 missense possibly damaging 0.79
R9358:Dnah14 UTSW 1 181709033 missense probably benign 0.01
R9436:Dnah14 UTSW 1 181680783 missense probably damaging 1.00
R9484:Dnah14 UTSW 1 181690208 missense probably benign 0.45
R9484:Dnah14 UTSW 1 181797746 missense probably benign 0.01
R9486:Dnah14 UTSW 1 181680929 missense possibly damaging 0.68
R9546:Dnah14 UTSW 1 181593427 critical splice acceptor site probably null
R9547:Dnah14 UTSW 1 181593427 critical splice acceptor site probably null
R9578:Dnah14 UTSW 1 181674442 missense probably benign 0.16
R9654:Dnah14 UTSW 1 181766339 missense probably benign 0.01
R9681:Dnah14 UTSW 1 181734849 missense possibly damaging 0.91
R9683:Dnah14 UTSW 1 181598944 missense probably benign 0.01
R9687:Dnah14 UTSW 1 181598413 missense probably benign 0.01
R9718:Dnah14 UTSW 1 181622979 missense probably benign 0.08
R9751:Dnah14 UTSW 1 181792045 missense probably damaging 1.00
R9757:Dnah14 UTSW 1 181685784 missense probably benign 0.03
RF007:Dnah14 UTSW 1 181685809 missense probably benign 0.00
RF012:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181757351 missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181690320 missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181763334 missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181766304 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2021-04-30