Incidental Mutation 'R8812:Ppp6r2'
ID672524
Institutional Source Beutler Lab
Gene Symbol Ppp6r2
Ensembl Gene ENSMUSG00000036561
Gene Nameprotein phosphatase 6, regulatory subunit 2
SynonymsPp6r2, Saps2, 1110033O10Rik, 8430411H09Rik, B230107H12Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R8812 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location89211553-89287010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89283072 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 830 (V830A)
Ref Sequence ENSEMBL: ENSMUSP00000086167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088788] [ENSMUST00000228284]
Predicted Effect probably benign
Transcript: ENSMUST00000088788
AA Change: V830A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086167
Gene: ENSMUSG00000036561
AA Change: V830A

DomainStartEndE-ValueType
Pfam:SAPS 128 365 1.7e-73 PFAM
Pfam:SAPS 361 534 2.4e-47 PFAM
low complexity region 606 618 N/A INTRINSIC
low complexity region 788 802 N/A INTRINSIC
low complexity region 867 900 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228284
AA Change: V830A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase regulatory subunits, such as SAPS2, modulate the activity of protein phosphatase catalytic subunits by restricting substrate specificity, recruiting substrates, and determining the intracellular localization of the holoenzyme. SAPS2 is a regulatory subunit for the protein phosphatase-6 catalytic subunit (PPP6C; MIM 612725) (Stefansson and Brautigan, 2006 [PubMed 16769727]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,332,352 P1167Q probably damaging Het
Adcy10 A T 1: 165,551,298 Q885H probably damaging Het
Alkal2 C T 12: 30,890,056 L139F probably damaging Het
Ankrd17 A T 5: 90,293,203 M439K probably benign Het
Arl11 C A 14: 61,310,973 Y77* probably null Het
Bcas3 T C 11: 85,559,147 Y669H probably benign Het
Bpifb3 C T 2: 153,922,596 A136V probably benign Het
Btbd11 A G 10: 85,627,249 Q626R probably damaging Het
C87414 T C 5: 93,637,801 T207A possibly damaging Het
Ccne2 A G 4: 11,202,279 T345A probably benign Het
Ciz1 T C 2: 32,364,274 S76P probably benign Het
Clip4 A T 17: 71,800,805 K94* probably null Het
Cthrc1 G A 15: 39,084,471 R195H probably damaging Het
D430042O09Rik A C 7: 125,797,695 R309S probably benign Het
Ddx31 T C 2: 28,840,804 probably benign Het
Elf2 T A 3: 51,266,767 D113V possibly damaging Het
Esrrb A G 12: 86,488,550 N155S probably benign Het
Fam198b T C 3: 79,908,771 S363P possibly damaging Het
Flnb A G 14: 7,887,624 D478G probably benign Het
Galm T A 17: 80,127,786 L24H probably damaging Het
Gm14124 T A 2: 150,267,704 C105S possibly damaging Het
Gon4l G A 3: 88,895,007 G975D possibly damaging Het
Hspbp1 T G 7: 4,664,784 M237L probably benign Het
Ighv1-62-1 A T 12: 115,386,747 M100K probably damaging Het
Ipo8 A T 6: 148,775,077 D971E possibly damaging Het
Itgax C T 7: 128,133,807 A286V probably damaging Het
Jpt2 T C 17: 24,960,604 Q3R probably benign Het
Klrg2 A C 6: 38,636,903 L55R probably damaging Het
Lrp6 T A 6: 134,456,178 M1397L probably benign Het
Lrrc31 T A 3: 30,679,179 Q462L probably benign Het
Lyg2 T A 1: 37,909,973 I103F probably damaging Het
Map10 T C 8: 125,669,925 V19A probably damaging Het
Map1b T A 13: 99,432,815 M1133L unknown Het
Mrgpra4 A G 7: 47,981,733 V40A probably benign Het
Myh1 G A 11: 67,209,141 G626R probably benign Het
Myo9a T C 9: 59,779,747 V45A probably benign Het
Ncdn A G 4: 126,745,112 F638S possibly damaging Het
Ncs1 T A 2: 31,284,201 M121K probably damaging Het
Nf1 T C 11: 79,546,354 V16A probably damaging Het
Nktr T A 9: 121,750,251 D1128E unknown Het
Nup205 T G 6: 35,214,334 L1000R probably damaging Het
Obscn T C 11: 59,035,095 E5604G probably damaging Het
Olfr1240 A G 2: 89,439,865 V138A probably benign Het
Olfr1260 G T 2: 89,978,371 A198S possibly damaging Het
Olfr1370 T C 13: 21,073,050 N84D probably damaging Het
Olfr1446 A T 19: 12,890,196 V127E probably damaging Het
Olfr409-ps1 T A 11: 74,317,708 S228T unknown Het
Olfr615 G T 7: 103,560,609 C44F probably benign Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Ovch2 T A 7: 107,793,255 I294F probably damaging Het
Ovch2 A T 7: 107,794,044 C207* probably null Het
P3h2 T A 16: 25,982,717 Y397F possibly damaging Het
Pappa A T 4: 65,204,929 I834F possibly damaging Het
Pcdha11 T C 18: 37,007,663 S782P probably benign Het
Pex1 T C 5: 3,631,614 V980A probably benign Het
Pik3c2a G T 7: 116,351,877 L1258I probably damaging Het
Pmp22 T A 11: 63,158,413 *161R probably null Het
Ppp1r26 T A 2: 28,451,180 M274K probably benign Het
Prss1 T A 6: 41,462,586 N84K probably benign Het
Rab3il1 G A 19: 10,026,777 A18T probably damaging Het
Sbf2 A T 7: 110,329,862 S1471T probably damaging Het
Setdb1 T A 3: 95,356,060 D45V probably damaging Het
Sik3 G T 9: 46,178,513 V275L probably benign Het
Skint6 C A 4: 112,988,952 M659I probably benign Het
Slc24a1 T A 9: 64,928,703 D714V unknown Het
Slc26a5 T A 5: 21,813,882 D653V probably damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Stradb A G 1: 58,994,319 I380M probably benign Het
Sult1e1 T C 5: 87,587,642 Y59C probably benign Het
Tas2r122 C T 6: 132,711,739 A64T probably benign Het
Tep1 C T 14: 50,837,132 C1812Y probably damaging Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Trio A T 15: 27,905,225 C152S unknown Het
Tro G A X: 150,655,559 S34L unknown Het
Vmn1r15 A G 6: 57,258,138 probably benign Het
Vmn1r19 A G 6: 57,404,451 probably benign Het
Vmn1r75 A G 7: 11,880,703 T121A possibly damaging Het
Vmn2r32 A G 7: 7,474,670 F241L probably damaging Het
Vmn2r66 A G 7: 85,005,685 L472P probably damaging Het
Ylpm1 G T 12: 84,996,792 W101C unknown Het
Zdbf2 C A 1: 63,308,113 H1884N probably benign Het
Other mutations in Ppp6r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Ppp6r2 APN 15 89285813 missense probably benign 0.44
IGL00480:Ppp6r2 APN 15 89265249 splice site probably benign
IGL01061:Ppp6r2 APN 15 89286015 splice site probably benign
IGL01116:Ppp6r2 APN 15 89281989 missense probably damaging 1.00
IGL01317:Ppp6r2 APN 15 89285928 missense possibly damaging 0.62
IGL01947:Ppp6r2 APN 15 89278726 missense probably damaging 1.00
IGL01969:Ppp6r2 APN 15 89275510 missense probably damaging 0.99
IGL01999:Ppp6r2 APN 15 89269952 missense probably benign 0.09
IGL02634:Ppp6r2 APN 15 89275477 nonsense probably null
IGL02697:Ppp6r2 APN 15 89256755 missense probably benign 0.38
IGL02964:Ppp6r2 APN 15 89259175 missense probably damaging 1.00
IGL03107:Ppp6r2 APN 15 89268545 missense probably damaging 0.98
IGL03195:Ppp6r2 APN 15 89268555 missense possibly damaging 0.50
R0020:Ppp6r2 UTSW 15 89259139 missense probably damaging 1.00
R0020:Ppp6r2 UTSW 15 89259139 missense probably damaging 1.00
R0183:Ppp6r2 UTSW 15 89285787 missense probably damaging 0.99
R0745:Ppp6r2 UTSW 15 89265242 critical splice donor site probably null
R0835:Ppp6r2 UTSW 15 89268582 missense possibly damaging 0.90
R0959:Ppp6r2 UTSW 15 89274176 missense possibly damaging 0.81
R1661:Ppp6r2 UTSW 15 89253051 missense possibly damaging 0.96
R1867:Ppp6r2 UTSW 15 89281938 missense probably benign 0.01
R2081:Ppp6r2 UTSW 15 89282129 missense probably benign 0.01
R2102:Ppp6r2 UTSW 15 89278746 missense probably damaging 1.00
R2291:Ppp6r2 UTSW 15 89275487 missense probably damaging 1.00
R2900:Ppp6r2 UTSW 15 89281995 missense probably damaging 1.00
R3805:Ppp6r2 UTSW 15 89265639 missense probably benign 0.30
R3965:Ppp6r2 UTSW 15 89259114 missense probably benign 0.20
R4374:Ppp6r2 UTSW 15 89265158 missense probably damaging 1.00
R4901:Ppp6r2 UTSW 15 89259069 missense possibly damaging 0.88
R5055:Ppp6r2 UTSW 15 89282949 missense probably benign 0.01
R5668:Ppp6r2 UTSW 15 89280399 missense probably damaging 1.00
R5739:Ppp6r2 UTSW 15 89259073 missense probably benign 0.02
R6026:Ppp6r2 UTSW 15 89282910 missense probably benign 0.02
R6058:Ppp6r2 UTSW 15 89253252 critical splice donor site probably null
R6488:Ppp6r2 UTSW 15 89268538 missense probably benign 0.12
R6631:Ppp6r2 UTSW 15 89253255 splice site probably null
R6633:Ppp6r2 UTSW 15 89253255 splice site probably null
R6744:Ppp6r2 UTSW 15 89256661 critical splice acceptor site probably null
R7149:Ppp6r2 UTSW 15 89262396 missense probably damaging 1.00
R7754:Ppp6r2 UTSW 15 89256701 missense probably benign 0.12
R8326:Ppp6r2 UTSW 15 89280447 missense probably benign 0.05
R8861:Ppp6r2 UTSW 15 89259165 missense probably damaging 1.00
R8960:Ppp6r2 UTSW 15 89253036 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- TTGCAGTTGGTCCTACCTCG -3'
(R):5'- CACTGTTGTCTAAGAAGCCCTCTG -3'

Sequencing Primer
(F):5'- CTCGCCTTGTGCCTGGAATG -3'
(R):5'- AGGCACTGTTTTTCTAGAGACAGC -3'
Posted On2021-04-30