Incidental Mutation 'R8812:Stradb'
ID672452
Institutional Source Beutler Lab
Gene Symbol Stradb
Ensembl Gene ENSMUSG00000026027
Gene NameSTE20-related kinase adaptor beta
SynonymsAls2cr2, D1Ucla2, PRO1038
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8812 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location58973522-58995715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58994319 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 380 (I380M)
Ref Sequence ENSEMBL: ENSMUSP00000027185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027185] [ENSMUST00000114296] [ENSMUST00000123301] [ENSMUST00000153990]
Predicted Effect probably benign
Transcript: ENSMUST00000027185
AA Change: I380M

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000027185
Gene: ENSMUSG00000026027
AA Change: I380M

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 58 290 3.2e-26 PFAM
Pfam:Pkinase 58 369 7.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114296
SMART Domains Protein: ENSMUSP00000109935
Gene: ENSMUSG00000026027

DomainStartEndE-ValueType
Pfam:Pkinase 58 185 1.1e-16 PFAM
Pfam:Pkinase_Tyr 58 188 1.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123301
SMART Domains Protein: ENSMUSP00000138036
Gene: ENSMUSG00000026027

DomainStartEndE-ValueType
Pfam:Pkinase 58 184 2.7e-17 PFAM
Pfam:Pkinase_Tyr 58 185 1.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152318
Predicted Effect probably benign
Transcript: ENSMUST00000153990
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine/threonine protein kinase STE20 subfamily. One of the active site residues in the protein kinase domain of this protein is altered, and it is thus a pseudokinase. This protein is a component of a complex involved in the activation of serine/threonine kinase 11, a master kinase that regulates cell polarity and energy-generating metabolism. This complex regulates the relocation of this kinase from the nucleus to the cytoplasm, and it is essential for G1 cell cycle arrest mediated by this kinase. The protein encoded by this gene can also interact with the X chromosome-linked inhibitor of apoptosis protein, and this interaction enhances the anti-apoptotic activity of this protein via the JNK1 signal transduction pathway. Two pseudogenes, located on chromosomes 1 and 7, have been found for this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,332,352 P1167Q probably damaging Het
Adcy10 A T 1: 165,551,298 Q885H probably damaging Het
Alkal2 C T 12: 30,890,056 L139F probably damaging Het
Ankrd17 A T 5: 90,293,203 M439K probably benign Het
Arl11 C A 14: 61,310,973 Y77* probably null Het
Bcas3 T C 11: 85,559,147 Y669H probably benign Het
Bpifb3 C T 2: 153,922,596 A136V probably benign Het
Btbd11 A G 10: 85,627,249 Q626R probably damaging Het
C87414 T C 5: 93,637,801 T207A possibly damaging Het
Ccne2 A G 4: 11,202,279 T345A probably benign Het
Ciz1 T C 2: 32,364,274 S76P probably benign Het
Clip4 A T 17: 71,800,805 K94* probably null Het
Cthrc1 G A 15: 39,084,471 R195H probably damaging Het
D430042O09Rik A C 7: 125,797,695 R309S probably benign Het
Ddx31 T C 2: 28,840,804 probably benign Het
Elf2 T A 3: 51,266,767 D113V possibly damaging Het
Esrrb A G 12: 86,488,550 N155S probably benign Het
Fam198b T C 3: 79,908,771 S363P possibly damaging Het
Flnb A G 14: 7,887,624 D478G probably benign Het
Galm T A 17: 80,127,786 L24H probably damaging Het
Gm14124 T A 2: 150,267,704 C105S possibly damaging Het
Gon4l G A 3: 88,895,007 G975D possibly damaging Het
Hspbp1 T G 7: 4,664,784 M237L probably benign Het
Ighv1-62-1 A T 12: 115,386,747 M100K probably damaging Het
Ipo8 A T 6: 148,775,077 D971E possibly damaging Het
Itgax C T 7: 128,133,807 A286V probably damaging Het
Jpt2 T C 17: 24,960,604 Q3R probably benign Het
Klrg2 A C 6: 38,636,903 L55R probably damaging Het
Lrp6 T A 6: 134,456,178 M1397L probably benign Het
Lrrc31 T A 3: 30,679,179 Q462L probably benign Het
Lyg2 T A 1: 37,909,973 I103F probably damaging Het
Map10 T C 8: 125,669,925 V19A probably damaging Het
Map1b T A 13: 99,432,815 M1133L unknown Het
Mrgpra4 A G 7: 47,981,733 V40A probably benign Het
Myh1 G A 11: 67,209,141 G626R probably benign Het
Myo9a T C 9: 59,779,747 V45A probably benign Het
Ncdn A G 4: 126,745,112 F638S possibly damaging Het
Ncs1 T A 2: 31,284,201 M121K probably damaging Het
Nf1 T C 11: 79,546,354 V16A probably damaging Het
Nktr T A 9: 121,750,251 D1128E unknown Het
Nup205 T G 6: 35,214,334 L1000R probably damaging Het
Obscn T C 11: 59,035,095 E5604G probably damaging Het
Olfr1240 A G 2: 89,439,865 V138A probably benign Het
Olfr1260 G T 2: 89,978,371 A198S possibly damaging Het
Olfr1370 T C 13: 21,073,050 N84D probably damaging Het
Olfr1446 A T 19: 12,890,196 V127E probably damaging Het
Olfr409-ps1 T A 11: 74,317,708 S228T unknown Het
Olfr615 G T 7: 103,560,609 C44F probably benign Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Ovch2 T A 7: 107,793,255 I294F probably damaging Het
Ovch2 A T 7: 107,794,044 C207* probably null Het
P3h2 T A 16: 25,982,717 Y397F possibly damaging Het
Pappa A T 4: 65,204,929 I834F possibly damaging Het
Pcdha11 T C 18: 37,007,663 S782P probably benign Het
Pex1 T C 5: 3,631,614 V980A probably benign Het
Pik3c2a G T 7: 116,351,877 L1258I probably damaging Het
Pmp22 T A 11: 63,158,413 *161R probably null Het
Ppp1r26 T A 2: 28,451,180 M274K probably benign Het
Ppp6r2 T C 15: 89,283,072 V830A probably benign Het
Prss1 T A 6: 41,462,586 N84K probably benign Het
Rab3il1 G A 19: 10,026,777 A18T probably damaging Het
Sbf2 A T 7: 110,329,862 S1471T probably damaging Het
Setdb1 T A 3: 95,356,060 D45V probably damaging Het
Sik3 G T 9: 46,178,513 V275L probably benign Het
Skint6 C A 4: 112,988,952 M659I probably benign Het
Slc24a1 T A 9: 64,928,703 D714V unknown Het
Slc26a5 T A 5: 21,813,882 D653V probably damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Sult1e1 T C 5: 87,587,642 Y59C probably benign Het
Tas2r122 C T 6: 132,711,739 A64T probably benign Het
Tep1 C T 14: 50,837,132 C1812Y probably damaging Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Trio A T 15: 27,905,225 C152S unknown Het
Tro G A X: 150,655,559 S34L unknown Het
Vmn1r15 A G 6: 57,258,138 probably benign Het
Vmn1r19 A G 6: 57,404,451 probably benign Het
Vmn1r75 A G 7: 11,880,703 T121A possibly damaging Het
Vmn2r32 A G 7: 7,474,670 F241L probably damaging Het
Vmn2r66 A G 7: 85,005,685 L472P probably damaging Het
Ylpm1 G T 12: 84,996,792 W101C unknown Het
Zdbf2 C A 1: 63,308,113 H1884N probably benign Het
Other mutations in Stradb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00784:Stradb APN 1 58988529 missense probably damaging 0.98
IGL00843:Stradb APN 1 58994409 missense probably benign
IGL01288:Stradb APN 1 58992301 missense possibly damaging 0.61
IGL02045:Stradb APN 1 58989778 missense probably damaging 1.00
IGL02818:Stradb APN 1 58979962 missense probably damaging 0.99
P0047:Stradb UTSW 1 58989798 missense probably null 0.86
R0739:Stradb UTSW 1 58977015 unclassified probably benign
R0970:Stradb UTSW 1 58977060 missense possibly damaging 0.92
R1809:Stradb UTSW 1 58994390 missense possibly damaging 0.54
R1930:Stradb UTSW 1 58991105 missense probably benign 0.07
R1931:Stradb UTSW 1 58991105 missense probably benign 0.07
R1932:Stradb UTSW 1 58991105 missense probably benign 0.07
R2570:Stradb UTSW 1 58988584 missense probably damaging 1.00
R2919:Stradb UTSW 1 58992669 missense probably benign 0.44
R3104:Stradb UTSW 1 58992291 missense possibly damaging 0.86
R3105:Stradb UTSW 1 58992291 missense possibly damaging 0.86
R3106:Stradb UTSW 1 58992291 missense possibly damaging 0.86
R3772:Stradb UTSW 1 58985385 missense probably benign 0.04
R4120:Stradb UTSW 1 58980009 missense possibly damaging 0.92
R4417:Stradb UTSW 1 58994372 missense probably benign
R4569:Stradb UTSW 1 58979958 nonsense probably null
R4601:Stradb UTSW 1 58993572 missense probably damaging 0.98
R4758:Stradb UTSW 1 58988571 missense probably benign 0.02
R4786:Stradb UTSW 1 58991208 intron probably benign
R4944:Stradb UTSW 1 58980440 missense probably benign 0.27
R5113:Stradb UTSW 1 58991174 intron probably benign
R5568:Stradb UTSW 1 58992742 missense possibly damaging 0.72
R5765:Stradb UTSW 1 58992744 missense probably benign 0.31
R5970:Stradb UTSW 1 58980016 critical splice donor site probably null
R6234:Stradb UTSW 1 58988548 missense probably damaging 1.00
R7411:Stradb UTSW 1 58988518 missense possibly damaging 0.95
R7511:Stradb UTSW 1 58992949 missense probably damaging 0.97
R7569:Stradb UTSW 1 58991151 missense unknown
R7575:Stradb UTSW 1 58988580 missense probably benign 0.00
R7646:Stradb UTSW 1 58994408 missense probably benign 0.14
R7658:Stradb UTSW 1 58992726 missense probably damaging 0.96
R8306:Stradb UTSW 1 58991197 missense unknown
Z1176:Stradb UTSW 1 58992999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCGATTGTCAGAACTAGAAGC -3'
(R):5'- ATTCTCCAGTGCACCAACTG -3'

Sequencing Primer
(F):5'- TGTCAGAACTAGAAGCATTTAAAAGG -3'
(R):5'- GTCATTTGTACCTAACAGGACCG -3'
Posted On2021-04-30