Incidental Mutation 'R8812:Olfr1240'
ID672459
Institutional Source Beutler Lab
Gene Symbol Olfr1240
Ensembl Gene ENSMUSG00000111174
Gene Nameolfactory receptor 1240
SynonymsMOR231-8, GA_x6K02T2Q125-50883183-50882239
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R8812 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89436296-89443000 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89439865 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 138 (V138A)
Ref Sequence ENSEMBL: ENSMUSP00000150256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000215362] [ENSMUST00000216123]
Predicted Effect probably benign
Transcript: ENSMUST00000187363
AA Change: V138A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000139968
Gene: ENSMUSG00000099909
AA Change: V138A

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 2e-28 PFAM
Pfam:7tm_4 137 278 1.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215362
AA Change: V138A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000216123
AA Change: V138A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,332,352 P1167Q probably damaging Het
Adcy10 A T 1: 165,551,298 Q885H probably damaging Het
Alkal2 C T 12: 30,890,056 L139F probably damaging Het
Ankrd17 A T 5: 90,293,203 M439K probably benign Het
Arl11 C A 14: 61,310,973 Y77* probably null Het
Bcas3 T C 11: 85,559,147 Y669H probably benign Het
Bpifb3 C T 2: 153,922,596 A136V probably benign Het
Btbd11 A G 10: 85,627,249 Q626R probably damaging Het
C87414 T C 5: 93,637,801 T207A possibly damaging Het
Ccne2 A G 4: 11,202,279 T345A probably benign Het
Ciz1 T C 2: 32,364,274 S76P probably benign Het
Clip4 A T 17: 71,800,805 K94* probably null Het
Cthrc1 G A 15: 39,084,471 R195H probably damaging Het
D430042O09Rik A C 7: 125,797,695 R309S probably benign Het
Ddx31 T C 2: 28,840,804 probably benign Het
Elf2 T A 3: 51,266,767 D113V possibly damaging Het
Esrrb A G 12: 86,488,550 N155S probably benign Het
Fam198b T C 3: 79,908,771 S363P possibly damaging Het
Flnb A G 14: 7,887,624 D478G probably benign Het
Galm T A 17: 80,127,786 L24H probably damaging Het
Gm14124 T A 2: 150,267,704 C105S possibly damaging Het
Gon4l G A 3: 88,895,007 G975D possibly damaging Het
Hspbp1 T G 7: 4,664,784 M237L probably benign Het
Ighv1-62-1 A T 12: 115,386,747 M100K probably damaging Het
Ipo8 A T 6: 148,775,077 D971E possibly damaging Het
Itgax C T 7: 128,133,807 A286V probably damaging Het
Jpt2 T C 17: 24,960,604 Q3R probably benign Het
Klrg2 A C 6: 38,636,903 L55R probably damaging Het
Lrp6 T A 6: 134,456,178 M1397L probably benign Het
Lrrc31 T A 3: 30,679,179 Q462L probably benign Het
Lyg2 T A 1: 37,909,973 I103F probably damaging Het
Map10 T C 8: 125,669,925 V19A probably damaging Het
Map1b T A 13: 99,432,815 M1133L unknown Het
Mrgpra4 A G 7: 47,981,733 V40A probably benign Het
Myh1 G A 11: 67,209,141 G626R probably benign Het
Myo9a T C 9: 59,779,747 V45A probably benign Het
Ncdn A G 4: 126,745,112 F638S possibly damaging Het
Ncs1 T A 2: 31,284,201 M121K probably damaging Het
Nf1 T C 11: 79,546,354 V16A probably damaging Het
Nktr T A 9: 121,750,251 D1128E unknown Het
Nup205 T G 6: 35,214,334 L1000R probably damaging Het
Obscn T C 11: 59,035,095 E5604G probably damaging Het
Olfr1260 G T 2: 89,978,371 A198S possibly damaging Het
Olfr1370 T C 13: 21,073,050 N84D probably damaging Het
Olfr1446 A T 19: 12,890,196 V127E probably damaging Het
Olfr409-ps1 T A 11: 74,317,708 S228T unknown Het
Olfr615 G T 7: 103,560,609 C44F probably benign Het
Olfr834 A G 9: 18,988,516 H176R possibly damaging Het
Ovch2 T A 7: 107,793,255 I294F probably damaging Het
Ovch2 A T 7: 107,794,044 C207* probably null Het
P3h2 T A 16: 25,982,717 Y397F possibly damaging Het
Pappa A T 4: 65,204,929 I834F possibly damaging Het
Pcdha11 T C 18: 37,007,663 S782P probably benign Het
Pex1 T C 5: 3,631,614 V980A probably benign Het
Pik3c2a G T 7: 116,351,877 L1258I probably damaging Het
Pmp22 T A 11: 63,158,413 *161R probably null Het
Ppp1r26 T A 2: 28,451,180 M274K probably benign Het
Ppp6r2 T C 15: 89,283,072 V830A probably benign Het
Prss1 T A 6: 41,462,586 N84K probably benign Het
Rab3il1 G A 19: 10,026,777 A18T probably damaging Het
Sbf2 A T 7: 110,329,862 S1471T probably damaging Het
Setdb1 T A 3: 95,356,060 D45V probably damaging Het
Sik3 G T 9: 46,178,513 V275L probably benign Het
Skint6 C A 4: 112,988,952 M659I probably benign Het
Slc24a1 T A 9: 64,928,703 D714V unknown Het
Slc26a5 T A 5: 21,813,882 D653V probably damaging Het
Snrnp27 A T 6: 86,676,214 C141S probably benign Het
Stradb A G 1: 58,994,319 I380M probably benign Het
Sult1e1 T C 5: 87,587,642 Y59C probably benign Het
Tas2r122 C T 6: 132,711,739 A64T probably benign Het
Tep1 C T 14: 50,837,132 C1812Y probably damaging Het
Tln2 C A 9: 67,221,411 E1465D possibly damaging Het
Trio A T 15: 27,905,225 C152S unknown Het
Tro G A X: 150,655,559 S34L unknown Het
Vmn1r15 A G 6: 57,258,138 probably benign Het
Vmn1r19 A G 6: 57,404,451 probably benign Het
Vmn1r75 A G 7: 11,880,703 T121A possibly damaging Het
Vmn2r32 A G 7: 7,474,670 F241L probably damaging Het
Vmn2r66 A G 7: 85,005,685 L472P probably damaging Het
Ylpm1 G T 12: 84,996,792 W101C unknown Het
Zdbf2 C A 1: 63,308,113 H1884N probably benign Het
Other mutations in Olfr1240
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01765:Olfr1240 APN 2 89439800 missense probably benign 0.00
IGL01767:Olfr1240 APN 2 89439800 missense probably benign 0.00
R0375:Olfr1240 UTSW 2 89439396 missense probably benign 0.00
R0417:Olfr1240 UTSW 2 89440175 missense possibly damaging 0.88
R0501:Olfr1240 UTSW 2 89439716 missense probably benign 0.09
R0586:Olfr1240 UTSW 2 89439354 missense possibly damaging 0.55
R0624:Olfr1240 UTSW 2 89440138 missense possibly damaging 0.94
R1168:Olfr1240 UTSW 2 89439869 nonsense probably null
R1728:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R1729:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R1730:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R1739:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R1762:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R1783:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R1785:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R2038:Olfr1240 UTSW 2 89439345 missense probably benign 0.00
R2049:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R2069:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R2140:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R2142:Olfr1240 UTSW 2 89439583 missense probably benign 0.00
R2215:Olfr1240 UTSW 2 89440037 missense probably benign 0.00
R3714:Olfr1240 UTSW 2 89439383 missense probably damaging 1.00
R4304:Olfr1240 UTSW 2 89440198 missense probably damaging 0.96
R4437:Olfr1240 UTSW 2 89439354 missense possibly damaging 0.55
R4825:Olfr1240 UTSW 2 89439865 missense probably benign 0.01
R4857:Olfr1240 UTSW 2 89439623 missense probably damaging 1.00
R4865:Olfr1240 UTSW 2 89439659 missense possibly damaging 0.88
R5588:Olfr1240 UTSW 2 89439416 missense probably damaging 1.00
R5730:Olfr1240 UTSW 2 89439436 missense probably damaging 1.00
R7206:Olfr1240 UTSW 2 89440457 start gained probably benign
R7365:Olfr1240 UTSW 2 89440198 missense probably benign 0.01
R7574:Olfr1240 UTSW 2 89439401 missense possibly damaging 0.94
R8007:Olfr1240 UTSW 2 89440340
R8268:Olfr1240 UTSW 2 89439436 missense probably damaging 1.00
R8559:Olfr1240 UTSW 2 89440184 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CATTGGCAACCACAGTGAGC -3'
(R):5'- GATGCTGTTTACTCGACTGCC -3'

Sequencing Primer
(F):5'- CAGTGAGCCCAATTAAGTAAGTGTC -3'
(R):5'- TCTCACCCAAGTTGATTATGGAC -3'
Posted On2021-04-30