Incidental Mutation 'R9005:Parp8'
ID 685244
Institutional Source Beutler Lab
Gene Symbol Parp8
Ensembl Gene ENSMUSG00000021725
Gene Name poly (ADP-ribose) polymerase family, member 8
Synonyms D13Ertd275e, 2810430O08Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9005 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 116854820-117025537 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 116876590 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 638 (N638D)
Ref Sequence ENSEMBL: ENSMUSP00000022239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022239] [ENSMUST00000223949] [ENSMUST00000226107]
AlphaFold Q3UD82
Predicted Effect probably benign
Transcript: ENSMUST00000022239
AA Change: N638D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022239
Gene: ENSMUSG00000021725
AA Change: N638D

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
internal_repeat_1 332 410 4.61e-10 PROSPERO
internal_repeat_1 404 476 4.61e-10 PROSPERO
low complexity region 497 514 N/A INTRINSIC
Pfam:PARP 712 839 2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223949
AA Change: N599D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000226107
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik C T 19: 21,652,711 probably benign Het
Abcd4 C T 12: 84,608,582 W369* probably null Het
Abcf3 A G 16: 20,549,306 E98G probably benign Het
Acaca A T 11: 84,371,584 D2004V probably damaging Het
Acot5 G C 12: 84,069,856 M130I Het
Adamts3 C T 5: 89,677,834 E1049K probably benign Het
Agfg2 A T 5: 137,652,482 L456Q probably damaging Het
Agtr1b T A 3: 20,316,179 T88S possibly damaging Het
Amer2 G C 14: 60,379,927 D524H probably damaging Het
Ankrd61 T A 5: 143,894,858 T43S probably benign Het
Apcs A G 1: 172,894,209 L190P probably benign Het
Arsg A G 11: 109,490,520 K30E probably benign Het
Banp A T 8: 121,978,702 M104L possibly damaging Het
BC048403 A G 10: 121,750,596 Y272C probably damaging Het
BC080695 G A 4: 143,571,855 D123N probably benign Het
Caskin1 A G 17: 24,499,137 Q268R probably benign Het
Ccdc112 A G 18: 46,296,388 V81A probably damaging Het
Cfap44 T C 16: 44,460,154 I1432T probably damaging Het
Chd2 A T 7: 73,484,546 N684K probably damaging Het
Creb1 T C 1: 64,566,319 probably null Het
Ctsc C T 7: 88,278,294 T31I probably damaging Het
Cttnbp2 C A 6: 18,434,431 R476L probably damaging Het
Cwf19l1 T C 19: 44,123,214 D260G possibly damaging Het
Cyp24a1 A T 2: 170,494,085 S211T probably damaging Het
Ddx3y T C Y: 1,282,919 N46D probably damaging Het
Dgkz G T 2: 91,938,745 H653Q probably benign Het
Dnajc16 A T 4: 141,764,634 I626N possibly damaging Het
Dsc2 T C 18: 20,038,094 D616G probably benign Het
Dscam A T 16: 96,801,380 S621T probably damaging Het
Dst T A 1: 34,228,693 V3058E probably damaging Het
Ep400 A T 5: 110,711,093 C1125S unknown Het
Glyatl3 G A 17: 40,912,728 Q41* probably null Het
Gm7694 T G 1: 170,301,358 I201L probably damaging Het
Gnal C T 18: 67,088,759 R78* probably null Het
Gtf3c1 T C 7: 125,703,897 D122G probably benign Het
Htt G T 5: 34,817,751 D622Y possibly damaging Het
Igkv4-92 A G 6: 68,755,097 C98R probably benign Het
Incenp G A 19: 9,877,724 R608* probably null Het
Kif3c G A 12: 3,401,706 R679H probably damaging Het
Kng1 T A 16: 23,079,396 H515Q probably damaging Het
Lamb2 T C 9: 108,484,171 probably null Het
Malrd1 A T 2: 15,845,329 N1253I unknown Het
Map3k21 A T 8: 125,910,732 D19V Het
March2 G T 17: 33,696,233 P129Q probably damaging Het
Mier2 G A 10: 79,548,440 R166W probably damaging Het
Ms4a4d T A 19: 11,556,200 D148E possibly damaging Het
Myl4 A G 11: 104,577,558 D36G probably damaging Het
Olfr1375 G A 11: 51,048,111 M1I probably null Het
Olfr206 A T 16: 59,345,566 I45N probably damaging Het
Olfr235 A G 19: 12,268,340 T37A probably benign Het
Olfr447 T C 6: 42,912,236 S238P probably damaging Het
Pard3 G A 8: 127,277,166 S123N probably damaging Het
Pgpep1l A T 7: 68,237,658 S65T probably damaging Het
Ppp1r13b A G 12: 111,830,274 V1068A probably benign Het
Prkd1 G A 12: 50,383,402 Q641* probably null Het
Ptgr2 T C 12: 84,298,099 V82A possibly damaging Het
Rbm34 G A 8: 126,959,582 P225S possibly damaging Het
Rnps1 A T 17: 24,418,522 K46I unknown Het
Shank1 T C 7: 44,352,985 V1376A probably benign Het
Ski A T 4: 155,221,860 Y221N probably damaging Het
Skint6 C A 4: 113,238,150 G104V probably damaging Het
Slit2 G A 5: 48,302,518 C1380Y possibly damaging Het
Smpd3 C T 8: 106,257,426 G554S probably benign Het
Sorbs2 T G 8: 45,795,737 V675G probably benign Het
Spdl1 C A 11: 34,809,708 C605F possibly damaging Het
Syne1 C A 10: 5,205,406 D5568Y probably benign Het
Tac1 C A 6: 7,559,141 A111D possibly damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tnfrsf1a T C 6: 125,356,915 C44R probably damaging Het
Traf3ip3 T C 1: 193,181,977 Q366R probably benign Het
Trip10 A G 17: 57,262,416 D479G probably damaging Het
Trip11 T C 12: 101,878,872 T1536A probably benign Het
Tstd3 G T 4: 21,767,082 A13E possibly damaging Het
Urb1 T C 16: 90,753,790 K2058R probably benign Het
Usp15 A T 10: 123,146,798 I304N possibly damaging Het
Usp18 T G 6: 121,252,570 H49Q probably benign Het
Vmn1r56 T A 7: 5,196,390 D76V probably damaging Het
Wnk1 A G 6: 119,962,432 S167P probably damaging Het
Zfp229 G A 17: 21,746,750 A654T possibly damaging Het
Zfp977 C T 7: 42,580,658 V148I probably benign Het
Znfx1 A T 2: 167,038,736 I1240N Het
Other mutations in Parp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Parp8 APN 13 116927323 missense probably damaging 1.00
IGL01346:Parp8 APN 13 116895064 missense possibly damaging 0.72
IGL01793:Parp8 APN 13 116910879 missense probably damaging 1.00
IGL01926:Parp8 APN 13 116862302 splice site probably benign
IGL01958:Parp8 APN 13 116876572 missense probably benign 0.14
IGL02131:Parp8 APN 13 116910873 missense probably benign 0.08
IGL02398:Parp8 APN 13 116910863 critical splice donor site probably null
IGL02496:Parp8 APN 13 116862302 splice site probably benign
IGL03135:Parp8 APN 13 116910942 missense probably benign 0.41
IGL03143:Parp8 APN 13 116910961 splice site probably benign
IGL03201:Parp8 APN 13 116863069 splice site probably benign
blondi UTSW 13 116893041 missense possibly damaging 0.77
Heidi UTSW 13 116862204 splice site probably null
R0362:Parp8 UTSW 13 116924968 nonsense probably null
R0699:Parp8 UTSW 13 116922584 missense probably benign 0.01
R1445:Parp8 UTSW 13 117025350 splice site probably null
R1676:Parp8 UTSW 13 116877528 missense probably damaging 0.99
R1977:Parp8 UTSW 13 116910913 missense probably damaging 0.96
R2019:Parp8 UTSW 13 116868432 splice site probably benign
R2049:Parp8 UTSW 13 116894886 missense probably benign 0.20
R2142:Parp8 UTSW 13 116894886 missense probably benign 0.20
R2474:Parp8 UTSW 13 116893041 missense possibly damaging 0.77
R2566:Parp8 UTSW 13 116895687 missense possibly damaging 0.78
R3863:Parp8 UTSW 13 116894767 missense probably benign 0.01
R4126:Parp8 UTSW 13 116868469 missense possibly damaging 0.94
R4518:Parp8 UTSW 13 116895673 missense possibly damaging 0.62
R4519:Parp8 UTSW 13 116895673 missense possibly damaging 0.62
R4767:Parp8 UTSW 13 116868536 missense probably damaging 0.99
R5355:Parp8 UTSW 13 116862204 splice site probably null
R5633:Parp8 UTSW 13 116876580 missense probably damaging 1.00
R5942:Parp8 UTSW 13 116869433 missense probably benign 0.12
R5978:Parp8 UTSW 13 116895732 missense probably benign 0.01
R6039:Parp8 UTSW 13 116877598 missense probably damaging 1.00
R6039:Parp8 UTSW 13 116877598 missense probably damaging 1.00
R6753:Parp8 UTSW 13 116895115 missense possibly damaging 0.91
R7016:Parp8 UTSW 13 116895091 missense probably damaging 1.00
R7139:Parp8 UTSW 13 117025266 missense probably benign 0.21
R7305:Parp8 UTSW 13 116894925 missense possibly damaging 0.95
R7314:Parp8 UTSW 13 116868460 missense probably benign 0.01
R7360:Parp8 UTSW 13 116895771 missense probably benign 0.02
R7526:Parp8 UTSW 13 116894805 missense probably damaging 1.00
R8078:Parp8 UTSW 13 116924983 missense probably damaging 1.00
R8108:Parp8 UTSW 13 116867073 nonsense probably null
R8372:Parp8 UTSW 13 116855250 missense probably damaging 1.00
R9072:Parp8 UTSW 13 116911415 missense probably damaging 1.00
R9073:Parp8 UTSW 13 116911415 missense probably damaging 1.00
R9351:Parp8 UTSW 13 116864245 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGCAGAGTTGAATTAGACCATC -3'
(R):5'- AGATATCAACCCTCTGTCCCTG -3'

Sequencing Primer
(F):5'- GAGTTGAATTAGACCATCCTCTCACG -3'
(R):5'- GTCCCTGCTTCATCTTAATACAC -3'
Posted On 2021-10-11