Incidental Mutation 'R9110:Itih5'
ID 692178
Institutional Source Beutler Lab
Gene Symbol Itih5
Ensembl Gene ENSMUSG00000025780
Gene Name inter-alpha (globulin) inhibitor H5
Synonyms 5430408M01Rik, 4631408O11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R9110 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 10153571-10256529 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 10187020 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 122 (V122A)
Ref Sequence ENSEMBL: ENSMUSP00000026886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026886]
AlphaFold Q8BJD1
Predicted Effect probably benign
Transcript: ENSMUST00000026886
AA Change: V122A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026886
Gene: ENSMUSG00000025780
AA Change: V122A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
Pfam:VIT 51 159 5.5e-27 PFAM
VWA 293 476 5.84e-24 SMART
Pfam:ITI_HC_C 716 909 1.7e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 120,232,392 probably benign Het
Adam20 A G 8: 40,795,870 D339G probably benign Het
Adam3 T A 8: 24,703,805 Y397F probably benign Het
Ago3 C T 4: 126,355,036 G574E probably damaging Het
Angptl4 T A 17: 33,780,826 Y133F probably benign Het
Ankrd61 T C 5: 143,894,941 D15G possibly damaging Het
Arfgap1 T A 2: 180,973,537 S174T possibly damaging Het
Arhgap12 T C 18: 6,034,539 D549G possibly damaging Het
Arhgap25 T C 6: 87,476,272 E182G probably benign Het
Astn1 T G 1: 158,668,757 I1127S probably benign Het
Bivm T C 1: 44,129,366 probably null Het
Cdc42bpa T A 1: 180,117,693 S952T possibly damaging Het
Cfap44 T A 16: 44,435,560 L1005Q probably damaging Het
Cmklr1 G C 5: 113,613,982 H319Q probably benign Het
Cog1 T C 11: 113,653,981 F330L possibly damaging Het
Dnah2 T G 11: 69,544,382 D54A probably benign Het
Dntt A T 19: 41,055,758 probably null Het
Eml2 A G 7: 19,191,695 S240G probably benign Het
Fam174b G A 7: 73,766,623 probably benign Het
Fancd2 T C 6: 113,535,801 S33P possibly damaging Het
Fars2 A T 13: 36,246,419 M277L probably benign Het
Ifnar1 G A 16: 91,505,262 G542S probably benign Het
Jph3 A G 8: 121,789,462 I740V probably benign Het
Krtap16-1 C T 11: 99,986,560 C6Y probably benign Het
Mpeg1 A T 19: 12,462,650 T491S probably benign Het
Mroh8 T A 2: 157,213,685 I998L possibly damaging Het
Nrxn1 G A 17: 90,561,805 Q124* probably null Het
Nup188 T A 2: 30,332,449 S1028T possibly damaging Het
Nxf1 A T 19: 8,767,754 H456L probably damaging Het
Olfr1152 T A 2: 87,868,199 D69E probably damaging Het
Olfr136 C A 17: 38,335,543 P129T probably damaging Het
Olfr171 T A 16: 19,624,993 I36F possibly damaging Het
Olfr313 T A 11: 58,817,133 S42T possibly damaging Het
Olfr798 T A 10: 129,625,951 I37F possibly damaging Het
Otx2 T C 14: 48,658,770 N277S probably damaging Het
Pax4 T C 6: 28,445,202 N158S probably benign Het
Pgm1 T G 5: 64,103,816 S218A probably benign Het
Plb1 T C 5: 32,364,058 S1418P probably benign Het
Prkd3 T A 17: 78,985,322 D107V probably damaging Het
Prl2a1 A G 13: 27,808,415 E174G probably benign Het
Prr7 C T 13: 55,472,761 P194L probably damaging Het
Psmd2 T C 16: 20,652,244 S46P probably damaging Het
Ptbp2 C T 3: 119,747,609 A231T possibly damaging Het
Rae1 A G 2: 173,012,223 T265A probably benign Het
Rrnad1 G A 3: 87,927,671 H57Y probably benign Het
Sct T C 7: 141,279,094 E2G unknown Het
Sec14l3 T G 11: 4,065,007 probably null Het
Sfxn3 T A 19: 45,050,288 N131K probably damaging Het
Slc18a2 A T 19: 59,293,894 D511V probably benign Het
Slc20a2 T C 8: 22,535,441 I53T probably damaging Het
Smad4 T C 18: 73,649,870 D331G probably damaging Het
Srms C T 2: 181,206,257 R485H Het
Szt2 C A 4: 118,385,433 A1486S possibly damaging Het
Tmem87b C T 2: 128,842,695 Q459* probably null Het
Vdr A T 15: 97,884,872 I23N probably damaging Het
Vmn1r204 T C 13: 22,556,394 V65A possibly damaging Het
Vps33b A G 7: 80,289,995 D498G probably benign Het
Zfp442 T A 2: 150,408,173 Y603F probably benign Het
Zfp853 T A 5: 143,289,565 Q115L unknown Het
Zmiz2 C A 11: 6,398,271 Q303K probably benign Het
Other mutations in Itih5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Itih5 APN 2 10190289 missense probably damaging 1.00
IGL02125:Itih5 APN 2 10240987 missense probably benign
IGL02370:Itih5 APN 2 10186975 missense probably benign 0.05
IGL03376:Itih5 APN 2 10206773 missense probably benign 0.12
IGL02991:Itih5 UTSW 2 10251351 missense probably benign 0.01
R0090:Itih5 UTSW 2 10164684 missense probably benign 0.03
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0096:Itih5 UTSW 2 10251378 missense probably benign 0.02
R0158:Itih5 UTSW 2 10234992 splice site probably benign
R0270:Itih5 UTSW 2 10251264 missense probably benign 0.38
R0276:Itih5 UTSW 2 10185564 missense possibly damaging 0.80
R0807:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0810:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0903:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0905:Itih5 UTSW 2 10249188 missense probably benign 0.00
R0906:Itih5 UTSW 2 10249188 missense probably benign 0.00
R1104:Itih5 UTSW 2 10251512 missense probably benign 0.03
R1397:Itih5 UTSW 2 10240807 missense probably benign 0.14
R1671:Itih5 UTSW 2 10186971 missense probably benign 0.03
R1971:Itih5 UTSW 2 10238568 missense probably damaging 1.00
R3684:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3685:Itih5 UTSW 2 10238624 missense possibly damaging 0.93
R3831:Itih5 UTSW 2 10251270 missense possibly damaging 0.95
R3934:Itih5 UTSW 2 10245544 missense probably damaging 0.98
R4670:Itih5 UTSW 2 10190369 missense probably benign 0.01
R4803:Itih5 UTSW 2 10240581 missense probably benign
R4950:Itih5 UTSW 2 10235081 missense probably damaging 0.98
R5020:Itih5 UTSW 2 10240504 splice site probably null
R5735:Itih5 UTSW 2 10240761 missense probably benign 0.00
R6454:Itih5 UTSW 2 10240668 missense probably benign
R6662:Itih5 UTSW 2 10249181 missense probably benign 0.13
R7019:Itih5 UTSW 2 10190327 missense probably damaging 1.00
R7068:Itih5 UTSW 2 10249304 missense probably damaging 0.99
R7246:Itih5 UTSW 2 10187062 splice site probably null
R7424:Itih5 UTSW 2 10245637 missense probably damaging 1.00
R7452:Itih5 UTSW 2 10238796 missense probably damaging 1.00
R7597:Itih5 UTSW 2 10249376 missense probably damaging 1.00
R8025:Itih5 UTSW 2 10241022 missense probably benign 0.13
R8253:Itih5 UTSW 2 10238595 missense probably benign 0.06
R8349:Itih5 UTSW 2 10186989 missense probably benign 0.01
R8439:Itih5 UTSW 2 10235058 missense probably benign 0.19
R8449:Itih5 UTSW 2 10186989 missense probably benign 0.01
R8825:Itih5 UTSW 2 10190420 missense probably benign 0.00
R9582:Itih5 UTSW 2 10190202 missense probably benign 0.07
X0026:Itih5 UTSW 2 10238559 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGATACTTCAAGGCTGGTGC -3'
(R):5'- ACCCTTTCAATGGAAGAGTAGAG -3'

Sequencing Primer
(F):5'- AGTGTGGAATGCACTCTATCTGC -3'
(R):5'- AGAGGCAGGAATAGGTCTTTGTGTAC -3'
Posted On 2021-12-30